FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628317_at:

>probe:Drosophila_2:1628317_at:589:485; Interrogation_Position=105; Antisense; GTACGTCGGGAATCAGTTGCCACTT
>probe:Drosophila_2:1628317_at:206:469; Interrogation_Position=120; Antisense; GTTGCCACTTAGAAATCCCGCTCAA
>probe:Drosophila_2:1628317_at:648:193; Interrogation_Position=153; Antisense; AACTCGTCCAAGTCGCGTGATTCCA
>probe:Drosophila_2:1628317_at:86:549; Interrogation_Position=189; Antisense; GGAGGAAACGATGCGCCACTCCATA
>probe:Drosophila_2:1628317_at:359:673; Interrogation_Position=212; Antisense; TAGCCGACAACCTGATGGAGATCCT
>probe:Drosophila_2:1628317_at:341:365; Interrogation_Position=240; Antisense; GAATATGACTAATCCGCAGCATCGA
>probe:Drosophila_2:1628317_at:615:115; Interrogation_Position=257; Antisense; AGCATCGACAACAGTGCTTTTCCCT
>probe:Drosophila_2:1628317_at:632:699; Interrogation_Position=274; Antisense; TTTTCCCTCTTGCAGGTGGACGATG
>probe:Drosophila_2:1628317_at:394:587; Interrogation_Position=290; Antisense; TGGACGATGCTCTGCAGGCACGCAG
>probe:Drosophila_2:1628317_at:175:619; Interrogation_Position=302; Antisense; TGCAGGCACGCAGTCGAATCCTATG
>probe:Drosophila_2:1628317_at:503:683; Interrogation_Position=323; Antisense; TATGCCTCCTGCAGCAAATCGACGA
>probe:Drosophila_2:1628317_at:424:255; Interrogation_Position=337; Antisense; CAAATCGACGAGAGGCGCAGGACGC
>probe:Drosophila_2:1628317_at:39:211; Interrogation_Position=73; Antisense; AAGCAAACTGATGAGTATCCCAATG
>probe:Drosophila_2:1628317_at:559:683; Interrogation_Position=88; Antisense; TATCCCAATGAAGAGCAGTACGTCG

Paste this into a BLAST search page for me
GTACGTCGGGAATCAGTTGCCACTTGTTGCCACTTAGAAATCCCGCTCAAAACTCGTCCAAGTCGCGTGATTCCAGGAGGAAACGATGCGCCACTCCATATAGCCGACAACCTGATGGAGATCCTGAATATGACTAATCCGCAGCATCGAAGCATCGACAACAGTGCTTTTCCCTTTTTCCCTCTTGCAGGTGGACGATGTGGACGATGCTCTGCAGGCACGCAGTGCAGGCACGCAGTCGAATCCTATGTATGCCTCCTGCAGCAAATCGACGACAAATCGACGAGAGGCGCAGGACGCAAGCAAACTGATGAGTATCCCAATGTATCCCAATGAAGAGCAGTACGTCG

Full Affymetrix probeset data:

Annotations for 1628317_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720