FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628318_at:

>probe:Drosophila_2:1628318_at:705:625; Interrogation_Position=5504; Antisense; TGCCGATGAATCCTAGCGACGAGAT
>probe:Drosophila_2:1628318_at:303:569; Interrogation_Position=5533; Antisense; GGCAGTGATGAGACGGCTTTCTTGA
>probe:Drosophila_2:1628318_at:242:19; Interrogation_Position=5559; Antisense; ATTTCTCAACGGCATTGATCGCAGA
>probe:Drosophila_2:1628318_at:711:153; Interrogation_Position=5611; Antisense; AAAGTTTTAGATCTTCTAGCGCAGA
>probe:Drosophila_2:1628318_at:727:391; Interrogation_Position=5690; Antisense; GAAAGTGCATCGACCAGGAACCCAT
>probe:Drosophila_2:1628318_at:609:73; Interrogation_Position=5705; Antisense; AGGAACCCATCGTGCGTCTCGAGAA
>probe:Drosophila_2:1628318_at:527:497; Interrogation_Position=5720; Antisense; GTCTCGAGAAGATCACTTTCCTTAT
>probe:Drosophila_2:1628318_at:594:301; Interrogation_Position=5791; Antisense; CCCGAACTGCATCTCTTCAATGAAA
>probe:Drosophila_2:1628318_at:534:483; Interrogation_Position=5823; Antisense; GTATCTGCCCAAGGGAATTCCTTTC
>probe:Drosophila_2:1628318_at:609:361; Interrogation_Position=5837; Antisense; GAATTCCTTTCCTCGAAGCCTTTCT
>probe:Drosophila_2:1628318_at:517:449; Interrogation_Position=5866; Antisense; GATCCCGAGCAGTACCTTAGAAAAT
>probe:Drosophila_2:1628318_at:23:51; Interrogation_Position=5893; Antisense; ATGCGTATGTTAGACTACCTTTTAA
>probe:Drosophila_2:1628318_at:630:227; Interrogation_Position=5937; Antisense; AATGCATTCGTCTGCGTTTTTTAAC
>probe:Drosophila_2:1628318_at:430:421; Interrogation_Position=6026; Antisense; GAGCAACCATTACTATAAGTCCTTT

Paste this into a BLAST search page for me
TGCCGATGAATCCTAGCGACGAGATGGCAGTGATGAGACGGCTTTCTTGAATTTCTCAACGGCATTGATCGCAGAAAAGTTTTAGATCTTCTAGCGCAGAGAAAGTGCATCGACCAGGAACCCATAGGAACCCATCGTGCGTCTCGAGAAGTCTCGAGAAGATCACTTTCCTTATCCCGAACTGCATCTCTTCAATGAAAGTATCTGCCCAAGGGAATTCCTTTCGAATTCCTTTCCTCGAAGCCTTTCTGATCCCGAGCAGTACCTTAGAAAATATGCGTATGTTAGACTACCTTTTAAAATGCATTCGTCTGCGTTTTTTAACGAGCAACCATTACTATAAGTCCTTT

Full Affymetrix probeset data:

Annotations for 1628318_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720