FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628320_at:

>probe:Drosophila_2:1628320_at:365:207; Interrogation_Position=418; Antisense; AAGCTGGAGGCTACCACGGAGCTAT
>probe:Drosophila_2:1628320_at:515:69; Interrogation_Position=479; Antisense; AGGCCAAACTGACCAAATTCTCTAT
>probe:Drosophila_2:1628320_at:179:247; Interrogation_Position=494; Antisense; AATTCTCTATTGTCATGTCCTCGTT
>probe:Drosophila_2:1628320_at:267:513; Interrogation_Position=550; Antisense; GTGTTCCACCGCCTAAACGAGGAGC
>probe:Drosophila_2:1628320_at:98:609; Interrogation_Position=593; Antisense; TGACCAAGGCCTGCGATCTAGACTG
>probe:Drosophila_2:1628320_at:293:453; Interrogation_Position=607; Antisense; GATCTAGACTGGATCGCCATTCTGC
>probe:Drosophila_2:1628320_at:175:93; Interrogation_Position=722; Antisense; AGTTCATTATCGACAGCCTGGAGCA
>probe:Drosophila_2:1628320_at:526:197; Interrogation_Position=746; Antisense; AACCGGAGCACTACCGCAAGGTTTG
>probe:Drosophila_2:1628320_at:698:675; Interrogation_Position=799; Antisense; TAGAACTATCTATCACCCAATGGGA
>probe:Drosophila_2:1628320_at:636:465; Interrogation_Position=822; Antisense; GATTGTGACCAATTGCAGCTGATCA
>probe:Drosophila_2:1628320_at:264:601; Interrogation_Position=881; Antisense; TGTAGTCCTCTATAGTTCGCCAAAT
>probe:Drosophila_2:1628320_at:585:93; Interrogation_Position=894; Antisense; AGTTCGCCAAATGTTTGCACACCCG
>probe:Drosophila_2:1628320_at:102:47; Interrogation_Position=920; Antisense; ATCCGTATCTACGTACTGTGAGCGC
>probe:Drosophila_2:1628320_at:251:511; Interrogation_Position=937; Antisense; GTGAGCGCACAATAAACTTTCCATT

Paste this into a BLAST search page for me
AAGCTGGAGGCTACCACGGAGCTATAGGCCAAACTGACCAAATTCTCTATAATTCTCTATTGTCATGTCCTCGTTGTGTTCCACCGCCTAAACGAGGAGCTGACCAAGGCCTGCGATCTAGACTGGATCTAGACTGGATCGCCATTCTGCAGTTCATTATCGACAGCCTGGAGCAAACCGGAGCACTACCGCAAGGTTTGTAGAACTATCTATCACCCAATGGGAGATTGTGACCAATTGCAGCTGATCATGTAGTCCTCTATAGTTCGCCAAATAGTTCGCCAAATGTTTGCACACCCGATCCGTATCTACGTACTGTGAGCGCGTGAGCGCACAATAAACTTTCCATT

Full Affymetrix probeset data:

Annotations for 1628320_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720