FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628321_at:

>probe:Drosophila_2:1628321_at:687:181; Interrogation_Position=1005; Antisense; AAAACGCTTGGGTCAACTACTACAG
>probe:Drosophila_2:1628321_at:261:663; Interrogation_Position=1022; Antisense; TACTACAGCGACCTACCCTAAATAT
>probe:Drosophila_2:1628321_at:517:595; Interrogation_Position=1083; Antisense; TGTGTGTTTCCTAAATGTATATCCA
>probe:Drosophila_2:1628321_at:107:519; Interrogation_Position=1146; Antisense; GTGGGATTGCTTAGCTCATAATCAT
>probe:Drosophila_2:1628321_at:419:563; Interrogation_Position=1267; Antisense; GGAAGAATACTTCATCATCACCAAT
>probe:Drosophila_2:1628321_at:206:37; Interrogation_Position=1280; Antisense; ATCATCACCAATGCAGTTCTGTTTA
>probe:Drosophila_2:1628321_at:421:725; Interrogation_Position=810; Antisense; TTGGCGGTGAATCCTTCAGCTCCAG
>probe:Drosophila_2:1628321_at:399:643; Interrogation_Position=854; Antisense; TCTCCCAGCTGTCAGTGCAGTTCAA
>probe:Drosophila_2:1628321_at:12:617; Interrogation_Position=869; Antisense; TGCAGTTCAAGCTGACTCCGTGGAT
>probe:Drosophila_2:1628321_at:292:315; Interrogation_Position=895; Antisense; GCCTTCAGGCGGAGCTTGTCGAGTT
>probe:Drosophila_2:1628321_at:254:95; Interrogation_Position=907; Antisense; AGCTTGTCGAGTTGCGACGTACGGT
>probe:Drosophila_2:1628321_at:278:343; Interrogation_Position=937; Antisense; GCTTGGAGGAGAATAGTCGCCGCTA
>probe:Drosophila_2:1628321_at:306:25; Interrogation_Position=949; Antisense; ATAGTCGCCGCTAGATGACCGACTT
>probe:Drosophila_2:1628321_at:7:609; Interrogation_Position=964; Antisense; TGACCGACTTCCCTTTGCGGAGGAA

Paste this into a BLAST search page for me
AAAACGCTTGGGTCAACTACTACAGTACTACAGCGACCTACCCTAAATATTGTGTGTTTCCTAAATGTATATCCAGTGGGATTGCTTAGCTCATAATCATGGAAGAATACTTCATCATCACCAATATCATCACCAATGCAGTTCTGTTTATTGGCGGTGAATCCTTCAGCTCCAGTCTCCCAGCTGTCAGTGCAGTTCAATGCAGTTCAAGCTGACTCCGTGGATGCCTTCAGGCGGAGCTTGTCGAGTTAGCTTGTCGAGTTGCGACGTACGGTGCTTGGAGGAGAATAGTCGCCGCTAATAGTCGCCGCTAGATGACCGACTTTGACCGACTTCCCTTTGCGGAGGAA

Full Affymetrix probeset data:

Annotations for 1628321_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720