FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628322_at:

>probe:Drosophila_2:1628322_at:396:1; Interrogation_Position=1799; Antisense; AGGACAAGGACCTGGTTCCCTGCCG
>probe:Drosophila_2:1628322_at:340:269; Interrogation_Position=1841; Antisense; CATGCCGCTGGGTGCTCTACTGGAA
>probe:Drosophila_2:1628322_at:211:645; Interrogation_Position=1856; Antisense; TCTACTGGAACAGCAGCCGGCAAAC
>probe:Drosophila_2:1628322_at:405:511; Interrogation_Position=1908; Antisense; GTGAACTTTAAGCTGCTGCTGCACA
>probe:Drosophila_2:1628322_at:666:291; Interrogation_Position=1946; Antisense; CGTCGAGGACTCGTACAGCGATAAT
>probe:Drosophila_2:1628322_at:22:455; Interrogation_Position=1965; Antisense; GATAATGCCGAACTGTCGGCGGCCA
>probe:Drosophila_2:1628322_at:44:289; Interrogation_Position=1981; Antisense; CGGCGGCCACGCAAAATCTGGAGAA
>probe:Drosophila_2:1628322_at:309:383; Interrogation_Position=2003; Antisense; GAACGTTCTCGATAGCATCATCAAG
>probe:Drosophila_2:1628322_at:392:121; Interrogation_Position=2041; Antisense; AGCGGCGCATCAGCACGTGAGGATC
>probe:Drosophila_2:1628322_at:534:545; Interrogation_Position=2067; Antisense; GGATCGGATACCAACTCCCATCGAT
>probe:Drosophila_2:1628322_at:348:309; Interrogation_Position=2097; Antisense; CCAGACCAAGTCCACTTAGCTTTAA
>probe:Drosophila_2:1628322_at:514:159; Interrogation_Position=2160; Antisense; ACAACCGAGTCATGCATTTATTATA
>probe:Drosophila_2:1628322_at:256:689; Interrogation_Position=2178; Antisense; TATTATATCCTTCTTCCTTTTCCCA
>probe:Drosophila_2:1628322_at:322:719; Interrogation_Position=2197; Antisense; TTCCCATGTGCTTTAACATTCGCGT

Paste this into a BLAST search page for me
AGGACAAGGACCTGGTTCCCTGCCGCATGCCGCTGGGTGCTCTACTGGAATCTACTGGAACAGCAGCCGGCAAACGTGAACTTTAAGCTGCTGCTGCACACGTCGAGGACTCGTACAGCGATAATGATAATGCCGAACTGTCGGCGGCCACGGCGGCCACGCAAAATCTGGAGAAGAACGTTCTCGATAGCATCATCAAGAGCGGCGCATCAGCACGTGAGGATCGGATCGGATACCAACTCCCATCGATCCAGACCAAGTCCACTTAGCTTTAAACAACCGAGTCATGCATTTATTATATATTATATCCTTCTTCCTTTTCCCATTCCCATGTGCTTTAACATTCGCGT

Full Affymetrix probeset data:

Annotations for 1628322_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720