FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628324_at:

>probe:Drosophila_2:1628324_at:649:87; Interrogation_Position=4162; Antisense; AGTCGCAGCACCAATCGCTAGAAGG
>probe:Drosophila_2:1628324_at:333:595; Interrogation_Position=4193; Antisense; TGTGGATGACGTGCTAGCCAGGCCT
>probe:Drosophila_2:1628324_at:430:365; Interrogation_Position=4230; Antisense; GAATATCAGGCGTTGGACGCACAAA
>probe:Drosophila_2:1628324_at:330:39; Interrogation_Position=4265; Antisense; ATCTGCGAACAGTAGGGATTGTCTA
>probe:Drosophila_2:1628324_at:162:511; Interrogation_Position=4397; Antisense; GTGCAATACGGATGCCTGGCAGGCA
>probe:Drosophila_2:1628324_at:134:569; Interrogation_Position=4414; Antisense; GGCAGGCACAAAAGTCCACCGGAAA
>probe:Drosophila_2:1628324_at:462:393; Interrogation_Position=4454; Antisense; GAAATGAAACACTGTGACGCCCCGA
>probe:Drosophila_2:1628324_at:82:597; Interrogation_Position=4468; Antisense; TGACGCCCCGAAAGCCACTGAAAAT
>probe:Drosophila_2:1628324_at:111:533; Interrogation_Position=4534; Antisense; GGTGGAGATCCAACTAAACCTAATC
>probe:Drosophila_2:1628324_at:127:305; Interrogation_Position=4552; Antisense; CCTAATCCAGAATATGTAGCGCGTA
>probe:Drosophila_2:1628324_at:433:487; Interrogation_Position=4567; Antisense; GTAGCGCGTAAACAGAGCACTAAGT
>probe:Drosophila_2:1628324_at:209:183; Interrogation_Position=4684; Antisense; AAAACGGTCAATGGCAGCGGTGTAT
>probe:Drosophila_2:1628324_at:273:59; Interrogation_Position=4712; Antisense; ATGTATGTGTGGTCAGCCAGTGGCT
>probe:Drosophila_2:1628324_at:594:261; Interrogation_Position=4725; Antisense; CAGCCAGTGGCTATCGGTTATCGAT

Paste this into a BLAST search page for me
AGTCGCAGCACCAATCGCTAGAAGGTGTGGATGACGTGCTAGCCAGGCCTGAATATCAGGCGTTGGACGCACAAAATCTGCGAACAGTAGGGATTGTCTAGTGCAATACGGATGCCTGGCAGGCAGGCAGGCACAAAAGTCCACCGGAAAGAAATGAAACACTGTGACGCCCCGATGACGCCCCGAAAGCCACTGAAAATGGTGGAGATCCAACTAAACCTAATCCCTAATCCAGAATATGTAGCGCGTAGTAGCGCGTAAACAGAGCACTAAGTAAAACGGTCAATGGCAGCGGTGTATATGTATGTGTGGTCAGCCAGTGGCTCAGCCAGTGGCTATCGGTTATCGAT

Full Affymetrix probeset data:

Annotations for 1628324_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720