FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628325_at:

>probe:Drosophila_2:1628325_at:251:569; Interrogation_Position=1020; Antisense; GGCATTGCAACGAACTTTTGCGCTA
>probe:Drosophila_2:1628325_at:358:317; Interrogation_Position=1053; Antisense; GCCTGGCTGCTCATTTGTTTTTAAA
>probe:Drosophila_2:1628325_at:566:389; Interrogation_Position=1116; Antisense; GAAACTATTATTTTTGCCATCTGAT
>probe:Drosophila_2:1628325_at:464:295; Interrogation_Position=1148; Antisense; GCGAATGCCGTAGTTCTAAGTGCCT
>probe:Drosophila_2:1628325_at:415:219; Interrogation_Position=1165; Antisense; AAGTGCCTACTGACGTGCCTATAAC
>probe:Drosophila_2:1628325_at:464:261; Interrogation_Position=1276; Antisense; CAGCTAGCCGCCCATTTATTTATTA
>probe:Drosophila_2:1628325_at:5:5; Interrogation_Position=761; Antisense; ATTGTTAGCGGAGCAACGCTGGCCC
>probe:Drosophila_2:1628325_at:534:641; Interrogation_Position=787; Antisense; TCTGTTTATGGCCATGTGCTGTGTG
>probe:Drosophila_2:1628325_at:333:621; Interrogation_Position=803; Antisense; TGCTGTGTGGTTTTGTATCTGCGAC
>probe:Drosophila_2:1628325_at:698:483; Interrogation_Position=817; Antisense; GTATCTGCGACACGAGAAGCTGCAA
>probe:Drosophila_2:1628325_at:422:199; Interrogation_Position=874; Antisense; AACGACCGACGGTGGCTGTCAGAAC
>probe:Drosophila_2:1628325_at:355:435; Interrogation_Position=911; Antisense; GAGGTGGATGGCTTGCGACCCTTAC
>probe:Drosophila_2:1628325_at:443:721; Interrogation_Position=923; Antisense; TTGCGACCCTTACGTCCAGTGAGAC
>probe:Drosophila_2:1628325_at:690:435; Interrogation_Position=980; Antisense; GAGGAGGCCCACCTTCAAGCGAAAG

Paste this into a BLAST search page for me
GGCATTGCAACGAACTTTTGCGCTAGCCTGGCTGCTCATTTGTTTTTAAAGAAACTATTATTTTTGCCATCTGATGCGAATGCCGTAGTTCTAAGTGCCTAAGTGCCTACTGACGTGCCTATAACCAGCTAGCCGCCCATTTATTTATTAATTGTTAGCGGAGCAACGCTGGCCCTCTGTTTATGGCCATGTGCTGTGTGTGCTGTGTGGTTTTGTATCTGCGACGTATCTGCGACACGAGAAGCTGCAAAACGACCGACGGTGGCTGTCAGAACGAGGTGGATGGCTTGCGACCCTTACTTGCGACCCTTACGTCCAGTGAGACGAGGAGGCCCACCTTCAAGCGAAAG

Full Affymetrix probeset data:

Annotations for 1628325_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720