FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628326_at:

>probe:Drosophila_2:1628326_at:272:415; Interrogation_Position=121; Antisense; GACCAGCTGTTCGAATCCGTTTTCA
>probe:Drosophila_2:1628326_at:550:235; Interrogation_Position=134; Antisense; AATCCGTTTTCAGTGAGTCTTCGAA
>probe:Drosophila_2:1628326_at:398:107; Interrogation_Position=158; Antisense; AGAACTTGAACACTTTTGGCTACTG
>probe:Drosophila_2:1628326_at:679:701; Interrogation_Position=171; Antisense; TTTTGGCTACTGTATTTCTGCCCTC
>probe:Drosophila_2:1628326_at:591:645; Interrogation_Position=217; Antisense; TCATCAACAACATGGCTGACCCGCA
>probe:Drosophila_2:1628326_at:642:115; Interrogation_Position=272; Antisense; AGCTTTTCCGCGTCGCCATAAAATT
>probe:Drosophila_2:1628326_at:26:389; Interrogation_Position=343; Antisense; GAAAATGCACTCAGCCTCAAGGAAA
>probe:Drosophila_2:1628326_at:172:433; Interrogation_Position=420; Antisense; GAGTGCCAGGATAAGTTCCCGTTTC
>probe:Drosophila_2:1628326_at:348:163; Interrogation_Position=500; Antisense; AAATTCCCATTCGTTTTGTGCCAAT
>probe:Drosophila_2:1628326_at:444:219; Interrogation_Position=52; Antisense; AAGTGCTTCCATCGATCCGATCTAT
>probe:Drosophila_2:1628326_at:401:293; Interrogation_Position=532; Antisense; CGTTCCAGTCTGCATTTCATGTTTA
>probe:Drosophila_2:1628326_at:339:3; Interrogation_Position=562; Antisense; ATTGTGGAACACTCTTGTGGGCGAG
>probe:Drosophila_2:1628326_at:48:213; Interrogation_Position=613; Antisense; AAGACAACCATATACGACTCTCTCC
>probe:Drosophila_2:1628326_at:728:185; Interrogation_Position=88; Antisense; AACAATCCGATCGATCGGTCTCTGC

Paste this into a BLAST search page for me
GACCAGCTGTTCGAATCCGTTTTCAAATCCGTTTTCAGTGAGTCTTCGAAAGAACTTGAACACTTTTGGCTACTGTTTTGGCTACTGTATTTCTGCCCTCTCATCAACAACATGGCTGACCCGCAAGCTTTTCCGCGTCGCCATAAAATTGAAAATGCACTCAGCCTCAAGGAAAGAGTGCCAGGATAAGTTCCCGTTTCAAATTCCCATTCGTTTTGTGCCAATAAGTGCTTCCATCGATCCGATCTATCGTTCCAGTCTGCATTTCATGTTTAATTGTGGAACACTCTTGTGGGCGAGAAGACAACCATATACGACTCTCTCCAACAATCCGATCGATCGGTCTCTGC

Full Affymetrix probeset data:

Annotations for 1628326_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720