FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628328_at:

>probe:Drosophila_2:1628328_at:247:681; Interrogation_Position=147; Antisense; TATGTTACGCAAGAATCCCCAGCAC
>probe:Drosophila_2:1628328_at:229:315; Interrogation_Position=220; Antisense; GCCATCATCGGCTATCTGGTGAACA
>probe:Drosophila_2:1628328_at:215:533; Interrogation_Position=237; Antisense; GGTGAACAAGTACGCCCAGTCGGAT
>probe:Drosophila_2:1628328_at:416:545; Interrogation_Position=300; Antisense; GGATCAGCGGCTGCATTTCGAGACC
>probe:Drosophila_2:1628328_at:205:597; Interrogation_Position=327; Antisense; TGTCCTTTTTCACGGCATCTTCAAG
>probe:Drosophila_2:1628328_at:309:369; Interrogation_Position=378; Antisense; GAATGCCACTGAGGTGCCCAAGGAT
>probe:Drosophila_2:1628328_at:229:547; Interrogation_Position=420; Antisense; GGATGCCTACGCCTTGCTGGAGCAA
>probe:Drosophila_2:1628328_at:91:551; Interrogation_Position=453; Antisense; GGAGAATCCCTATGTGGCCGGTCCT
>probe:Drosophila_2:1628328_at:536:293; Interrogation_Position=492; Antisense; CGATTTTAGCATTGTGGCCACCGTG
>probe:Drosophila_2:1628328_at:468:441; Interrogation_Position=547; Antisense; GATGCGACCAAATACCCCAAATTAT
>probe:Drosophila_2:1628328_at:591:161; Interrogation_Position=565; Antisense; AAATTATCCGCCTGGTTGGCACGTA
>probe:Drosophila_2:1628328_at:248:303; Interrogation_Position=593; Antisense; CCGCATTGCCCTTCTATGAGGAGGA
>probe:Drosophila_2:1628328_at:439:73; Interrogation_Position=614; Antisense; AGGACAACTTGAGAGGAGCCCGCTT
>probe:Drosophila_2:1628328_at:40:125; Interrogation_Position=630; Antisense; AGCCCGCTTGTTGGCCGATAAGATT

Paste this into a BLAST search page for me
TATGTTACGCAAGAATCCCCAGCACGCCATCATCGGCTATCTGGTGAACAGGTGAACAAGTACGCCCAGTCGGATGGATCAGCGGCTGCATTTCGAGACCTGTCCTTTTTCACGGCATCTTCAAGGAATGCCACTGAGGTGCCCAAGGATGGATGCCTACGCCTTGCTGGAGCAAGGAGAATCCCTATGTGGCCGGTCCTCGATTTTAGCATTGTGGCCACCGTGGATGCGACCAAATACCCCAAATTATAAATTATCCGCCTGGTTGGCACGTACCGCATTGCCCTTCTATGAGGAGGAAGGACAACTTGAGAGGAGCCCGCTTAGCCCGCTTGTTGGCCGATAAGATT

Full Affymetrix probeset data:

Annotations for 1628328_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720