FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628329_at:

>probe:Drosophila_2:1628329_at:69:709; Interrogation_Position=1028; Antisense; TTAACGAGTTCGCTTGGCTTTGCAG
>probe:Drosophila_2:1628329_at:588:339; Interrogation_Position=1044; Antisense; GCTTTGCAGTCACCGGAAGTTCCGA
>probe:Drosophila_2:1628329_at:580:371; Interrogation_Position=1059; Antisense; GAAGTTCCGATTTCAACTGTGTGGA
>probe:Drosophila_2:1628329_at:393:37; Interrogation_Position=1120; Antisense; ATCATAACCACTTTCCTGTACTTAG
>probe:Drosophila_2:1628329_at:25:673; Interrogation_Position=586; Antisense; TACCATGTCGGTGTCCTGTTAATCT
>probe:Drosophila_2:1628329_at:598:643; Interrogation_Position=705; Antisense; TCTATCCTTATACAAACGCCTTCTA
>probe:Drosophila_2:1628329_at:532:105; Interrogation_Position=739; Antisense; AGAAAATTGGTGATCGCCTACGAAT
>probe:Drosophila_2:1628329_at:483:341; Interrogation_Position=792; Antisense; GCTATCTGGAAACATCGTGGTCATT
>probe:Drosophila_2:1628329_at:570:291; Interrogation_Position=807; Antisense; CGTGGTCATTTATTTCCTCATTGTA
>probe:Drosophila_2:1628329_at:428:149; Interrogation_Position=850; Antisense; ACTTATTCTATCTTCTTGGTGGCAT
>probe:Drosophila_2:1628329_at:170:345; Interrogation_Position=871; Antisense; GCATTCCCAAATTCCCTGTTAATAA
>probe:Drosophila_2:1628329_at:266:543; Interrogation_Position=903; Antisense; GGATTTCTGGTTGTGCATTGCCGCA
>probe:Drosophila_2:1628329_at:625:625; Interrogation_Position=921; Antisense; TGCCGCATGCGATCTTACCGAAAAG
>probe:Drosophila_2:1628329_at:591:181; Interrogation_Position=973; Antisense; AAAATATTTTCTGACCTCGAGCACA

Paste this into a BLAST search page for me
TTAACGAGTTCGCTTGGCTTTGCAGGCTTTGCAGTCACCGGAAGTTCCGAGAAGTTCCGATTTCAACTGTGTGGAATCATAACCACTTTCCTGTACTTAGTACCATGTCGGTGTCCTGTTAATCTTCTATCCTTATACAAACGCCTTCTAAGAAAATTGGTGATCGCCTACGAATGCTATCTGGAAACATCGTGGTCATTCGTGGTCATTTATTTCCTCATTGTAACTTATTCTATCTTCTTGGTGGCATGCATTCCCAAATTCCCTGTTAATAAGGATTTCTGGTTGTGCATTGCCGCATGCCGCATGCGATCTTACCGAAAAGAAAATATTTTCTGACCTCGAGCACA

Full Affymetrix probeset data:

Annotations for 1628329_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720