FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628330_at:

>probe:Drosophila_2:1628330_at:561:225; Interrogation_Position=127; Antisense; AAGGACGATGGTAGCTTTCTGGAGC
>probe:Drosophila_2:1628330_at:196:717; Interrogation_Position=143; Antisense; TTCTGGAGCACGTACTGTTCTGCAT
>probe:Drosophila_2:1628330_at:315:349; Interrogation_Position=173; Antisense; GCAGGAGCATTATGTCCTTCACCCA
>probe:Drosophila_2:1628330_at:452:233; Interrogation_Position=200; Antisense; AATCCACAACGAACCTGAGGCGTCA
>probe:Drosophila_2:1628330_at:156:131; Interrogation_Position=224; Antisense; ACCGGTGTCACCTGCAGTATCTCAA
>probe:Drosophila_2:1628330_at:645:7; Interrogation_Position=258; Antisense; ATTCTGCTGCTACAATTCCAAGGGC
>probe:Drosophila_2:1628330_at:562:719; Interrogation_Position=273; Antisense; TTCCAAGGGCGAATCCAACGACAGA
>probe:Drosophila_2:1628330_at:352:427; Interrogation_Position=358; Antisense; GAGTTGGAAACAAAACCCTCTCCTG
>probe:Drosophila_2:1628330_at:277:575; Interrogation_Position=418; Antisense; GGCGGAGATTCCACTGCAGCTTCAG
>probe:Drosophila_2:1628330_at:54:173; Interrogation_Position=50; Antisense; AAACCGGCGTCTACCAATTGGCTGT
>probe:Drosophila_2:1628330_at:4:61; Interrogation_Position=506; Antisense; ATGTTTATGCACAGACCTGGTCCCT
>probe:Drosophila_2:1628330_at:241:395; Interrogation_Position=586; Antisense; GAAATCTTCGTATTGGGCAGGCTAC
>probe:Drosophila_2:1628330_at:611:135; Interrogation_Position=609; Antisense; ACGACGCCTTACTCTGAATACGGTT
>probe:Drosophila_2:1628330_at:526:363; Interrogation_Position=624; Antisense; GAATACGGTTCCAACGGCGGAGTAG

Paste this into a BLAST search page for me
AAGGACGATGGTAGCTTTCTGGAGCTTCTGGAGCACGTACTGTTCTGCATGCAGGAGCATTATGTCCTTCACCCAAATCCACAACGAACCTGAGGCGTCAACCGGTGTCACCTGCAGTATCTCAAATTCTGCTGCTACAATTCCAAGGGCTTCCAAGGGCGAATCCAACGACAGAGAGTTGGAAACAAAACCCTCTCCTGGGCGGAGATTCCACTGCAGCTTCAGAAACCGGCGTCTACCAATTGGCTGTATGTTTATGCACAGACCTGGTCCCTGAAATCTTCGTATTGGGCAGGCTACACGACGCCTTACTCTGAATACGGTTGAATACGGTTCCAACGGCGGAGTAG

Full Affymetrix probeset data:

Annotations for 1628330_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720