Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628331_at:

>probe:Drosophila_2:1628331_at:75:163; Interrogation_Position=1205; Antisense; AAATGAACAACCACAACGCGACCCA
>probe:Drosophila_2:1628331_at:93:323; Interrogation_Position=1222; Antisense; GCGACCCAAGATCCCTACAGTACAA
>probe:Drosophila_2:1628331_at:483:667; Interrogation_Position=1237; Antisense; TACAGTACAACACCGCGCAAGAAAA
>probe:Drosophila_2:1628331_at:451:181; Interrogation_Position=1261; Antisense; AACAAAGGTTTGTCCACGTCTCTCA
>probe:Drosophila_2:1628331_at:568:259; Interrogation_Position=1275; Antisense; CACGTCTCTCATCAGAATCTCAGAA
>probe:Drosophila_2:1628331_at:486:185; Interrogation_Position=1316; Antisense; AAAATATCGCTAGCTCTTTCAGGGA
>probe:Drosophila_2:1628331_at:163:117; Interrogation_Position=1327; Antisense; AGCTCTTTCAGGGAGTTTCAGGAAT
>probe:Drosophila_2:1628331_at:349:215; Interrogation_Position=1396; Antisense; AAGTTAGCTACTCAGCTGTAGTTGA
>probe:Drosophila_2:1628331_at:349:627; Interrogation_Position=1564; Antisense; TCCAAAATTCGTATCATCTGTCCGT
>probe:Drosophila_2:1628331_at:322:647; Interrogation_Position=1577; Antisense; TCATCTGTCCGTAAAACTCTGTTTT
>probe:Drosophila_2:1628331_at:605:729; Interrogation_Position=1602; Antisense; TTGGCTAATTTGTAATGTCCTGCTA
>probe:Drosophila_2:1628331_at:699:651; Interrogation_Position=1614; Antisense; TAATGTCCTGCTAACCGAAACCCGT
>probe:Drosophila_2:1628331_at:691:271; Interrogation_Position=1685; Antisense; CATACACCCTCGAGTTGGCATTTTA
>probe:Drosophila_2:1628331_at:646:331; Interrogation_Position=1714; Antisense; GCATTAAATGGTGCGTAGACCGGTT

Paste this into a BLAST search page for me
AAATGAACAACCACAACGCGACCCAGCGACCCAAGATCCCTACAGTACAATACAGTACAACACCGCGCAAGAAAAAACAAAGGTTTGTCCACGTCTCTCACACGTCTCTCATCAGAATCTCAGAAAAAATATCGCTAGCTCTTTCAGGGAAGCTCTTTCAGGGAGTTTCAGGAATAAGTTAGCTACTCAGCTGTAGTTGATCCAAAATTCGTATCATCTGTCCGTTCATCTGTCCGTAAAACTCTGTTTTTTGGCTAATTTGTAATGTCCTGCTATAATGTCCTGCTAACCGAAACCCGTCATACACCCTCGAGTTGGCATTTTAGCATTAAATGGTGCGTAGACCGGTT

Full Affymetrix probeset data:

Annotations for 1628331_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime