FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628332_at:

>probe:Drosophila_2:1628332_at:647:553; Interrogation_Position=487; Antisense; GGAGCCAATAACATTGCCCTTCTGT
>probe:Drosophila_2:1628332_at:652:603; Interrogation_Position=509; Antisense; TGTTCCTAGCCAACCCATTTGAGTT
>probe:Drosophila_2:1628332_at:387:89; Interrogation_Position=530; Antisense; AGTTGAAAAGCCACATCCGAACCAT
>probe:Drosophila_2:1628332_at:131:265; Interrogation_Position=586; Antisense; CAGAAGCGCTGCTTGGTGACCGGAT
>probe:Drosophila_2:1628332_at:679:187; Interrogation_Position=679; Antisense; AACAGGGCGCAGTGCCAGGATCAGT
>probe:Drosophila_2:1628332_at:641:389; Interrogation_Position=707; Antisense; GAAACACCAGATTGGGCGTCTCGTT
>probe:Drosophila_2:1628332_at:338:605; Interrogation_Position=732; Antisense; TGATCTGCCTGCTAGTCTGATATGC
>probe:Drosophila_2:1628332_at:441:643; Interrogation_Position=807; Antisense; TCTATTCTGCCCCATGGAGGCGGAC
>probe:Drosophila_2:1628332_at:473:45; Interrogation_Position=834; Antisense; ATCGCGCTATGAGCAGGCTGGCATC
>probe:Drosophila_2:1628332_at:40:525; Interrogation_Position=867; Antisense; GGGCATCGGCTGTCAAGAGGAAAAC
>probe:Drosophila_2:1628332_at:590:557; Interrogation_Position=885; Antisense; GGAAAACGTTCCAGCAGTCTACACA
>probe:Drosophila_2:1628332_at:604:545; Interrogation_Position=932; Antisense; GGATCTATGAGCACATGGCCCAGAA
>probe:Drosophila_2:1628332_at:187:107; Interrogation_Position=953; Antisense; AGAACTCCAACAGTGTTCCATTCGC
>probe:Drosophila_2:1628332_at:385:635; Interrogation_Position=974; Antisense; TCGCTGCTGGTCAGTTACCATCGAA

Paste this into a BLAST search page for me
GGAGCCAATAACATTGCCCTTCTGTTGTTCCTAGCCAACCCATTTGAGTTAGTTGAAAAGCCACATCCGAACCATCAGAAGCGCTGCTTGGTGACCGGATAACAGGGCGCAGTGCCAGGATCAGTGAAACACCAGATTGGGCGTCTCGTTTGATCTGCCTGCTAGTCTGATATGCTCTATTCTGCCCCATGGAGGCGGACATCGCGCTATGAGCAGGCTGGCATCGGGCATCGGCTGTCAAGAGGAAAACGGAAAACGTTCCAGCAGTCTACACAGGATCTATGAGCACATGGCCCAGAAAGAACTCCAACAGTGTTCCATTCGCTCGCTGCTGGTCAGTTACCATCGAA

Full Affymetrix probeset data:

Annotations for 1628332_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720