FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628334_at:

>probe:Drosophila_2:1628334_at:456:75; Interrogation_Position=131; Antisense; AGGAGCAGAACCTCAAGAACGCCCT
>probe:Drosophila_2:1628334_at:686:209; Interrogation_Position=145; Antisense; AAGAACGCCCTCAAGGCCAACTCTT
>probe:Drosophila_2:1628334_at:610:69; Interrogation_Position=158; Antisense; AGGCCAACTCTTTGGAGTCTCTGGA
>probe:Drosophila_2:1628334_at:156:551; Interrogation_Position=171; Antisense; GGAGTCTCTGGAATCCATGGAAAAC
>probe:Drosophila_2:1628334_at:155:389; Interrogation_Position=190; Antisense; GAAAACAGCCGCAACGCCGATCTGG
>probe:Drosophila_2:1628334_at:411:323; Interrogation_Position=230; Antisense; GCGCCTCTCTGGAGTCCTGCGAGAA
>probe:Drosophila_2:1628334_at:66:589; Interrogation_Position=239; Antisense; TGGAGTCCTGCGAGAACGAGGCCAA
>probe:Drosophila_2:1628334_at:436:643; Interrogation_Position=270; Antisense; TCTCTCCCAGTCCTGCGAAATTGAG
>probe:Drosophila_2:1628334_at:659:395; Interrogation_Position=286; Antisense; GAAATTGAGGACTACGACTTCGAGC
>probe:Drosophila_2:1628334_at:217:75; Interrogation_Position=293; Antisense; AGGACTACGACTTCGAGCAACTGCC
>probe:Drosophila_2:1628334_at:635:641; Interrogation_Position=374; Antisense; TCTCCGATTTGCCAGCCGACAACGA
>probe:Drosophila_2:1628334_at:178:189; Interrogation_Position=40; Antisense; AACACCATGACCATCAAATCGAACA
>probe:Drosophila_2:1628334_at:223:237; Interrogation_Position=56; Antisense; AATCGAACAAGAAGCTGTCCTACAG
>probe:Drosophila_2:1628334_at:611:597; Interrogation_Position=71; Antisense; TGTCCTACAGCGTGAAGAAACTGCT

Paste this into a BLAST search page for me
AGGAGCAGAACCTCAAGAACGCCCTAAGAACGCCCTCAAGGCCAACTCTTAGGCCAACTCTTTGGAGTCTCTGGAGGAGTCTCTGGAATCCATGGAAAACGAAAACAGCCGCAACGCCGATCTGGGCGCCTCTCTGGAGTCCTGCGAGAATGGAGTCCTGCGAGAACGAGGCCAATCTCTCCCAGTCCTGCGAAATTGAGGAAATTGAGGACTACGACTTCGAGCAGGACTACGACTTCGAGCAACTGCCTCTCCGATTTGCCAGCCGACAACGAAACACCATGACCATCAAATCGAACAAATCGAACAAGAAGCTGTCCTACAGTGTCCTACAGCGTGAAGAAACTGCT

Full Affymetrix probeset data:

Annotations for 1628334_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720