FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628335_at:

>probe:Drosophila_2:1628335_at:189:281; Interrogation_Position=1500; Antisense; CTCGGCCCCAAATTTGTTCATTGAA
>probe:Drosophila_2:1628335_at:25:221; Interrogation_Position=1552; Antisense; AAGTGCGGCGAGATCATACGTCTGC
>probe:Drosophila_2:1628335_at:485:139; Interrogation_Position=1584; Antisense; ACGGAAGCTGGATCGAATTTACATT
>probe:Drosophila_2:1628335_at:206:697; Interrogation_Position=1601; Antisense; TTTACATTACCTCGGAACTGGCCCA
>probe:Drosophila_2:1628335_at:337:511; Interrogation_Position=1657; Antisense; GTGACCTTCTCCACATTGACAGGAG
>probe:Drosophila_2:1628335_at:382:225; Interrogation_Position=1693; Antisense; AAGGACAAGGTCCACTGCATCCAGC
>probe:Drosophila_2:1628335_at:235:49; Interrogation_Position=1711; Antisense; ATCCAGCCATGTGCGGATAGCGTTA
>probe:Drosophila_2:1628335_at:267:121; Interrogation_Position=1838; Antisense; AGCTGGCACAGGATGGCTTCTCCAA
>probe:Drosophila_2:1628335_at:651:439; Interrogation_Position=1849; Antisense; GATGGCTTCTCCAACATCAAGCTAG
>probe:Drosophila_2:1628335_at:727:149; Interrogation_Position=1862; Antisense; ACATCAAGCTAGACCGCACTGGCGG
>probe:Drosophila_2:1628335_at:476:337; Interrogation_Position=1888; Antisense; GCTCTGACTCTGAACCTTGTCAATG
>probe:Drosophila_2:1628335_at:98:73; Interrogation_Position=1913; Antisense; AGGACACAGTCATTAAGTTCGAGGA
>probe:Drosophila_2:1628335_at:498:423; Interrogation_Position=1942; Antisense; GAGACGCATATTATCTGCGGCGGAA
>probe:Drosophila_2:1628335_at:115:207; Interrogation_Position=1984; Antisense; AAGCTGCGAGACACCATCATGAAAT

Paste this into a BLAST search page for me
CTCGGCCCCAAATTTGTTCATTGAAAAGTGCGGCGAGATCATACGTCTGCACGGAAGCTGGATCGAATTTACATTTTTACATTACCTCGGAACTGGCCCAGTGACCTTCTCCACATTGACAGGAGAAGGACAAGGTCCACTGCATCCAGCATCCAGCCATGTGCGGATAGCGTTAAGCTGGCACAGGATGGCTTCTCCAAGATGGCTTCTCCAACATCAAGCTAGACATCAAGCTAGACCGCACTGGCGGGCTCTGACTCTGAACCTTGTCAATGAGGACACAGTCATTAAGTTCGAGGAGAGACGCATATTATCTGCGGCGGAAAAGCTGCGAGACACCATCATGAAAT

Full Affymetrix probeset data:

Annotations for 1628335_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720