Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628337_at:

>probe:Drosophila_2:1628337_at:621:69; Interrogation_Position=118; Antisense; AGGCCAAAGGTCACATTGCGTCCCT
>probe:Drosophila_2:1628337_at:425:7; Interrogation_Position=132; Antisense; ATTGCGTCCCTGTACAACAAGTATC
>probe:Drosophila_2:1628337_at:621:221; Interrogation_Position=165; Antisense; AATGATCGTGTGAATGGCAAGTCCA
>probe:Drosophila_2:1628337_at:704:369; Interrogation_Position=176; Antisense; GAATGGCAAGTCCAAAACCACTGAG
>probe:Drosophila_2:1628337_at:194:203; Interrogation_Position=191; Antisense; AACCACTGAGACATGCATGGAGGAA
>probe:Drosophila_2:1628337_at:333:547; Interrogation_Position=209; Antisense; GGAGGAATTGTTCGACTTCGTCGCT
>probe:Drosophila_2:1628337_at:596:295; Interrogation_Position=221; Antisense; CGACTTCGTCGCTGAATTGGATCAT
>probe:Drosophila_2:1628337_at:669:361; Interrogation_Position=234; Antisense; GAATTGGATCATTGCGTTGCTCACA
>probe:Drosophila_2:1628337_at:340:37; Interrogation_Position=241; Antisense; ATCATTGCGTTGCTCACAGTCTCTT
>probe:Drosophila_2:1628337_at:715:255; Interrogation_Position=255; Antisense; CACAGTCTCTTCTCGAAACTCAAAT
>probe:Drosophila_2:1628337_at:271:653; Interrogation_Position=29; Antisense; TAATAGCCGGGTTTTGGTGCCTGTC
>probe:Drosophila_2:1628337_at:622:503; Interrogation_Position=51; Antisense; GTCCTCAAGGCCGATGATGACGAAA
>probe:Drosophila_2:1628337_at:218:429; Interrogation_Position=78; Antisense; GAGTTAGTTGATCCGCAAGCAGCCC
>probe:Drosophila_2:1628337_at:568:449; Interrogation_Position=87; Antisense; GATCCGCAAGCAGCCCTTAGGGAGA

Paste this into a BLAST search page for me
AGGCCAAAGGTCACATTGCGTCCCTATTGCGTCCCTGTACAACAAGTATCAATGATCGTGTGAATGGCAAGTCCAGAATGGCAAGTCCAAAACCACTGAGAACCACTGAGACATGCATGGAGGAAGGAGGAATTGTTCGACTTCGTCGCTCGACTTCGTCGCTGAATTGGATCATGAATTGGATCATTGCGTTGCTCACAATCATTGCGTTGCTCACAGTCTCTTCACAGTCTCTTCTCGAAACTCAAATTAATAGCCGGGTTTTGGTGCCTGTCGTCCTCAAGGCCGATGATGACGAAAGAGTTAGTTGATCCGCAAGCAGCCCGATCCGCAAGCAGCCCTTAGGGAGA

Full Affymetrix probeset data:

Annotations for 1628337_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime