FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628338_at:

>probe:Drosophila_2:1628338_at:140:571; Interrogation_Position=1299; Antisense; GGCATTCACTCAAGAACCCGAAGTC
>probe:Drosophila_2:1628338_at:85:605; Interrogation_Position=1388; Antisense; TGATTTACTCAACTGGTCGCGTCGC
>probe:Drosophila_2:1628338_at:159:537; Interrogation_Position=1402; Antisense; GGTCGCGTCGCAGAAGCGATCAATA
>probe:Drosophila_2:1628338_at:272:453; Interrogation_Position=1453; Antisense; GATCTCAGTCTAAATGGTGCTACAA
>probe:Drosophila_2:1628338_at:185:111; Interrogation_Position=1477; Antisense; AGCAAAACCTTAGCCTTAGTACATA
>probe:Drosophila_2:1628338_at:351:291; Interrogation_Position=1591; Antisense; CGTACCTAAGTCCATCGAACAGCAA
>probe:Drosophila_2:1628338_at:284:179; Interrogation_Position=1671; Antisense; AAACACCCTCAGTACACAAACAAGT
>probe:Drosophila_2:1628338_at:42:95; Interrogation_Position=1693; Antisense; AGTTGAATTCTACTGCATACAAGCA
>probe:Drosophila_2:1628338_at:594:209; Interrogation_Position=1713; Antisense; AAGCAGCAACTAACTCCTATCTCTA
>probe:Drosophila_2:1628338_at:512:193; Interrogation_Position=1724; Antisense; AACTCCTATCTCTATGGAACATATC
>probe:Drosophila_2:1628338_at:60:167; Interrogation_Position=1760; Antisense; AAATGCGTCCGATTAGTCACGGCTT
>probe:Drosophila_2:1628338_at:90:677; Interrogation_Position=1773; Antisense; TAGTCACGGCTTTCCAACGGTTATA
>probe:Drosophila_2:1628338_at:478:195; Interrogation_Position=1788; Antisense; AACGGTTATAGCCTCCTGATCAATG
>probe:Drosophila_2:1628338_at:520:125; Interrogation_Position=1797; Antisense; AGCCTCCTGATCAATGCATTTTATG

Paste this into a BLAST search page for me
GGCATTCACTCAAGAACCCGAAGTCTGATTTACTCAACTGGTCGCGTCGCGGTCGCGTCGCAGAAGCGATCAATAGATCTCAGTCTAAATGGTGCTACAAAGCAAAACCTTAGCCTTAGTACATACGTACCTAAGTCCATCGAACAGCAAAAACACCCTCAGTACACAAACAAGTAGTTGAATTCTACTGCATACAAGCAAAGCAGCAACTAACTCCTATCTCTAAACTCCTATCTCTATGGAACATATCAAATGCGTCCGATTAGTCACGGCTTTAGTCACGGCTTTCCAACGGTTATAAACGGTTATAGCCTCCTGATCAATGAGCCTCCTGATCAATGCATTTTATG

Full Affymetrix probeset data:

Annotations for 1628338_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720