Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628339_a_at:

>probe:Drosophila_2:1628339_a_at:229:353; Interrogation_Position=249; Antisense; GCAGCAGTCTCTCCCCAGTGAAAAC
>probe:Drosophila_2:1628339_a_at:360:619; Interrogation_Position=292; Antisense; TGCATCTCGCGGACTTCTCGCTTAA
>probe:Drosophila_2:1628339_a_at:635:341; Interrogation_Position=311; Antisense; GCTTAACCCTTTGCGACGTGCGTGC
>probe:Drosophila_2:1628339_a_at:48:409; Interrogation_Position=325; Antisense; GACGTGCGTGCCTACAACAGAGTAC
>probe:Drosophila_2:1628339_a_at:295:329; Interrogation_Position=330; Antisense; GCGTGCCTACAACAGAGTACTCAGT
>probe:Drosophila_2:1628339_a_at:724:89; Interrogation_Position=352; Antisense; AGTACACACTACTACACTACACAGT
>probe:Drosophila_2:1628339_a_at:616:665; Interrogation_Position=369; Antisense; TACACAGTCCACCATGAGCAAACAA
>probe:Drosophila_2:1628339_a_at:75:609; Interrogation_Position=383; Antisense; TGAGCAAACAATTGGCGCGCCATGT
>probe:Drosophila_2:1628339_a_at:691:313; Interrogation_Position=401; Antisense; GCCATGTGGGCCAGCTGAACAGCCT
>probe:Drosophila_2:1628339_a_at:189:613; Interrogation_Position=416; Antisense; TGAACAGCCTCCTGAAGACGGCGGC
>probe:Drosophila_2:1628339_a_at:457:147; Interrogation_Position=470; Antisense; ACTACTTCACCTACGTGCGGGAGCT
>probe:Drosophila_2:1628339_a_at:19:507; Interrogation_Position=484; Antisense; GTGCGGGAGCTGTCGCATCCCATCG
>probe:Drosophila_2:1628339_a_at:509:103; Interrogation_Position=513; Antisense; AGAGCCTCCAATCGTCAAGCCGGAA
>probe:Drosophila_2:1628339_a_at:130:99; Interrogation_Position=537; Antisense; AGAGGCCGTGGCATGTGTAAAATCC

Paste this into a BLAST search page for me
GCAGCAGTCTCTCCCCAGTGAAAACTGCATCTCGCGGACTTCTCGCTTAAGCTTAACCCTTTGCGACGTGCGTGCGACGTGCGTGCCTACAACAGAGTACGCGTGCCTACAACAGAGTACTCAGTAGTACACACTACTACACTACACAGTTACACAGTCCACCATGAGCAAACAATGAGCAAACAATTGGCGCGCCATGTGCCATGTGGGCCAGCTGAACAGCCTTGAACAGCCTCCTGAAGACGGCGGCACTACTTCACCTACGTGCGGGAGCTGTGCGGGAGCTGTCGCATCCCATCGAGAGCCTCCAATCGTCAAGCCGGAAAGAGGCCGTGGCATGTGTAAAATCC

Full Affymetrix probeset data:

Annotations for 1628339_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime