FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628344_at:

>probe:Drosophila_2:1628344_at:534:21; Interrogation_Position=2543; Antisense; ATATATAGCTTTGGCTTTGTTCCAG
>probe:Drosophila_2:1628344_at:541:341; Interrogation_Position=2556; Antisense; GCTTTGTTCCAGTTGTAGCGGCATT
>probe:Drosophila_2:1628344_at:529:673; Interrogation_Position=2571; Antisense; TAGCGGCATTAATCGGTATAGTTTA
>probe:Drosophila_2:1628344_at:687:189; Interrogation_Position=2620; Antisense; AACTTTTCCATTTCTAATTCTACTG
>probe:Drosophila_2:1628344_at:306:713; Interrogation_Position=2637; Antisense; TTCTACTGAATTCAAATCGCCCTCC
>probe:Drosophila_2:1628344_at:54:681; Interrogation_Position=2681; Antisense; TTCTAATTCTTAACTCTAAACGTAT
>probe:Drosophila_2:1628344_at:476:177; Interrogation_Position=2698; Antisense; AAACGTATTGTATGTAGTGCGCAAA
>probe:Drosophila_2:1628344_at:597:505; Interrogation_Position=2714; Antisense; GTGCGCAAAAGCATTTTCACCCATT
>probe:Drosophila_2:1628344_at:20:173; Interrogation_Position=2721; Antisense; AAAGCATTTTCACCCATTTGTAATA
>probe:Drosophila_2:1628344_at:85:365; Interrogation_Position=2753; Antisense; GAATAGAAATTCTTCTGCCAAAACG
>probe:Drosophila_2:1628344_at:501:445; Interrogation_Position=2966; Antisense; GATCGATAGAAAGGCCGAGGACCGT
>probe:Drosophila_2:1628344_at:172:317; Interrogation_Position=2979; Antisense; GCCGAGGACCGTTGATAAGTTAATC
>probe:Drosophila_2:1628344_at:315:709; Interrogation_Position=2990; Antisense; TTGATAAGTTAATCTGGCGTGTGCA
>probe:Drosophila_2:1628344_at:227:41; Interrogation_Position=3001; Antisense; ATCTGGCGTGTGCAGAAAACTGTTT

Paste this into a BLAST search page for me
ATATATAGCTTTGGCTTTGTTCCAGGCTTTGTTCCAGTTGTAGCGGCATTTAGCGGCATTAATCGGTATAGTTTAAACTTTTCCATTTCTAATTCTACTGTTCTACTGAATTCAAATCGCCCTCCTTCTAATTCTTAACTCTAAACGTATAAACGTATTGTATGTAGTGCGCAAAGTGCGCAAAAGCATTTTCACCCATTAAAGCATTTTCACCCATTTGTAATAGAATAGAAATTCTTCTGCCAAAACGGATCGATAGAAAGGCCGAGGACCGTGCCGAGGACCGTTGATAAGTTAATCTTGATAAGTTAATCTGGCGTGTGCAATCTGGCGTGTGCAGAAAACTGTTT

Full Affymetrix probeset data:

Annotations for 1628344_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720