Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628345_at:

>probe:Drosophila_2:1628345_at:279:309; Interrogation_Position=1434; Antisense; CCAGAAGTGGATTGGCTTTACTAAT
>probe:Drosophila_2:1628345_at:174:21; Interrogation_Position=1461; Antisense; ATAGGTTCAAGTTCTCCGTTTGCGA
>probe:Drosophila_2:1628345_at:444:685; Interrogation_Position=1530; Antisense; TATCAAGCGAGACTGGCATCTTCTT
>probe:Drosophila_2:1628345_at:584:343; Interrogation_Position=1545; Antisense; GCATCTTCTTAAAAGTTGAACGCGT
>probe:Drosophila_2:1628345_at:107:503; Interrogation_Position=1597; Antisense; GTCCCTATTTTATATGGAATTCCAG
>probe:Drosophila_2:1628345_at:543:389; Interrogation_Position=1621; Antisense; GAAACAATGTTGCTCTATATCTATA
>probe:Drosophila_2:1628345_at:571:369; Interrogation_Position=1647; Antisense; GAATGTTAAGCTTATTAGTGTCTAA
>probe:Drosophila_2:1628345_at:343:515; Interrogation_Position=1664; Antisense; GTGTCTAATCGCAGTAGCATGCTTG
>probe:Drosophila_2:1628345_at:713:345; Interrogation_Position=1680; Antisense; GCATGCTTGTGGATAACTAACTACT
>probe:Drosophila_2:1628345_at:511:489; Interrogation_Position=1705; Antisense; GTAAGTTGGCTTTCATTTTATGGTT
>probe:Drosophila_2:1628345_at:404:285; Interrogation_Position=1753; Antisense; CTGGGTGATATATTGCCTTTTAAAG
>probe:Drosophila_2:1628345_at:105:663; Interrogation_Position=1773; Antisense; TAAAGGCTTCTTATTATTGCATAAT
>probe:Drosophila_2:1628345_at:597:241; Interrogation_Position=1823; Antisense; AATACTTTCGGCATTTCTTGGCAGA
>probe:Drosophila_2:1628345_at:40:715; Interrogation_Position=1837; Antisense; TTCTTGGCAGAAGCAATCTATGAAC

Paste this into a BLAST search page for me
CCAGAAGTGGATTGGCTTTACTAATATAGGTTCAAGTTCTCCGTTTGCGATATCAAGCGAGACTGGCATCTTCTTGCATCTTCTTAAAAGTTGAACGCGTGTCCCTATTTTATATGGAATTCCAGGAAACAATGTTGCTCTATATCTATAGAATGTTAAGCTTATTAGTGTCTAAGTGTCTAATCGCAGTAGCATGCTTGGCATGCTTGTGGATAACTAACTACTGTAAGTTGGCTTTCATTTTATGGTTCTGGGTGATATATTGCCTTTTAAAGTAAAGGCTTCTTATTATTGCATAATAATACTTTCGGCATTTCTTGGCAGATTCTTGGCAGAAGCAATCTATGAAC

Full Affymetrix probeset data:

Annotations for 1628345_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime