Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628348_at:

>probe:Drosophila_2:1628348_at:641:95; Interrogation_Position=1022; Antisense; AGATCTCCCGAACGCGGCTTTAAAG
>probe:Drosophila_2:1628348_at:231:77; Interrogation_Position=1045; Antisense; AGGAGTCCATCCTTCGTGCATGTAC
>probe:Drosophila_2:1628348_at:83:347; Interrogation_Position=1084; Antisense; GCATAACTGCGATTATTGCTCCCAA
>probe:Drosophila_2:1628348_at:150:237; Interrogation_Position=1107; Antisense; AATCTGGGTCCTCTATTGTCGCTGG
>probe:Drosophila_2:1628348_at:269:467; Interrogation_Position=1131; Antisense; GTTGGAGCGCTAACCATATCGCTGT
>probe:Drosophila_2:1628348_at:284:23; Interrogation_Position=1146; Antisense; ATATCGCTGTTGAACCTCGTATTTC
>probe:Drosophila_2:1628348_at:173:43; Interrogation_Position=1179; Antisense; ATCGAGATCTGTCTGTACTATCCGC
>probe:Drosophila_2:1628348_at:725:131; Interrogation_Position=1290; Antisense; ACCGTCTTCTCCATCAAGGACATGA
>probe:Drosophila_2:1628348_at:428:513; Interrogation_Position=1333; Antisense; GTGATACCACAACCGGAGGACCAGA
>probe:Drosophila_2:1628348_at:699:389; Interrogation_Position=1356; Antisense; GAAACCACCGCGGAGGAAACTACTG
>probe:Drosophila_2:1628348_at:403:389; Interrogation_Position=1371; Antisense; GAAACTACTGCTAACATGTCCGCCA
>probe:Drosophila_2:1628348_at:251:617; Interrogation_Position=1430; Antisense; TGCACTCCGTTTCAGATTTCTCTAA
>probe:Drosophila_2:1628348_at:400:645; Interrogation_Position=1466; Antisense; TCTTCAACCATGTGCGATCGTCAAT
>probe:Drosophila_2:1628348_at:190:575; Interrogation_Position=968; Antisense; GGCGGGATTCGTGATCATTGACATT

Paste this into a BLAST search page for me
AGATCTCCCGAACGCGGCTTTAAAGAGGAGTCCATCCTTCGTGCATGTACGCATAACTGCGATTATTGCTCCCAAAATCTGGGTCCTCTATTGTCGCTGGGTTGGAGCGCTAACCATATCGCTGTATATCGCTGTTGAACCTCGTATTTCATCGAGATCTGTCTGTACTATCCGCACCGTCTTCTCCATCAAGGACATGAGTGATACCACAACCGGAGGACCAGAGAAACCACCGCGGAGGAAACTACTGGAAACTACTGCTAACATGTCCGCCATGCACTCCGTTTCAGATTTCTCTAATCTTCAACCATGTGCGATCGTCAATGGCGGGATTCGTGATCATTGACATT

Full Affymetrix probeset data:

Annotations for 1628348_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime