FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628351_at:

>probe:Drosophila_2:1628351_at:152:551; Interrogation_Position=1105; Antisense; GGAGTTCTTCGACCTGGATGACATT
>probe:Drosophila_2:1628351_at:605:305; Interrogation_Position=1140; Antisense; CCAGTTTCCGTCTTTCCGAAATGAG
>probe:Drosophila_2:1628351_at:415:609; Interrogation_Position=1161; Antisense; TGAGCATGCAAAGCCCAAACAACTT
>probe:Drosophila_2:1628351_at:166:19; Interrogation_Position=1231; Antisense; ATTTGCCTTTGAGTAGTTTGACACA
>probe:Drosophila_2:1628351_at:155:623; Interrogation_Position=659; Antisense; TGCCAGAAACGAACCTCGGACTTTT
>probe:Drosophila_2:1628351_at:228:557; Interrogation_Position=676; Antisense; GGACTTTTCCCAGTTTATGGCGCAA
>probe:Drosophila_2:1628351_at:139:83; Interrogation_Position=702; Antisense; AGGGCTGTACCTACGGTGAGCACAA
>probe:Drosophila_2:1628351_at:129:221; Interrogation_Position=752; Antisense; AAGGTTGTGCAATGTCGCTACGACT
>probe:Drosophila_2:1628351_at:596:417; Interrogation_Position=838; Antisense; GAGCGTGATAGAGCTGAACCCCATC
>probe:Drosophila_2:1628351_at:478:71; Interrogation_Position=863; Antisense; AGGCTGCACGTCAACCTGGTATTTC
>probe:Drosophila_2:1628351_at:184:481; Interrogation_Position=881; Antisense; GTATTTCCCGAGCAGGACAACGCCA
>probe:Drosophila_2:1628351_at:168:413; Interrogation_Position=911; Antisense; GACCTGGACCTGGAATTGCGCGGAA
>probe:Drosophila_2:1628351_at:666:205; Interrogation_Position=955; Antisense; AAGCGCGCATATGTATGGCACCAAA
>probe:Drosophila_2:1628351_at:409:551; Interrogation_Position=982; Antisense; GGAGATTAAACTGCCCAAGCTGGAG

Paste this into a BLAST search page for me
GGAGTTCTTCGACCTGGATGACATTCCAGTTTCCGTCTTTCCGAAATGAGTGAGCATGCAAAGCCCAAACAACTTATTTGCCTTTGAGTAGTTTGACACATGCCAGAAACGAACCTCGGACTTTTGGACTTTTCCCAGTTTATGGCGCAAAGGGCTGTACCTACGGTGAGCACAAAAGGTTGTGCAATGTCGCTACGACTGAGCGTGATAGAGCTGAACCCCATCAGGCTGCACGTCAACCTGGTATTTCGTATTTCCCGAGCAGGACAACGCCAGACCTGGACCTGGAATTGCGCGGAAAAGCGCGCATATGTATGGCACCAAAGGAGATTAAACTGCCCAAGCTGGAG

Full Affymetrix probeset data:

Annotations for 1628351_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720