FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628353_at:

>probe:Drosophila_2:1628353_at:677:299; Interrogation_Position=278; Antisense; CGCGCCATCCAGGTGTATTTGGTGG
>probe:Drosophila_2:1628353_at:705:87; Interrogation_Position=306; Antisense; AGTACGGCAAGACCGACTCCCTGTA
>probe:Drosophila_2:1628353_at:454:653; Interrogation_Position=334; Antisense; TAAGTGCCCCAAGAAGCGCGCCGTG
>probe:Drosophila_2:1628353_at:511:151; Interrogation_Position=381; Antisense; ACATGGGAACGCTGTACCAGAGCTT
>probe:Drosophila_2:1628353_at:611:667; Interrogation_Position=416; Antisense; TACTACCCACAGGTGTTCGCCAAGG
>probe:Drosophila_2:1628353_at:420:307; Interrogation_Position=459; Antisense; CCTTCAAGAAGATCGAGGCCGCCTT
>probe:Drosophila_2:1628353_at:676:277; Interrogation_Position=484; Antisense; CGAGTTCCTGAACACCTTCCTGGAG
>probe:Drosophila_2:1628353_at:165:705; Interrogation_Position=537; Antisense; TTACCGTAGCCGACATTGCCCTGGT
>probe:Drosophila_2:1628353_at:592:565; Interrogation_Position=562; Antisense; GGCAACCGTGTCCACATTCGAGGTG
>probe:Drosophila_2:1628353_at:373:111; Interrogation_Position=602; Antisense; AGCAAGTACGCCAATGTGAACAGGT
>probe:Drosophila_2:1628353_at:362:195; Interrogation_Position=668; Antisense; AACTGGGCCGGATGCCTGGAGTTCA
>probe:Drosophila_2:1628353_at:323:649; Interrogation_Position=719; Antisense; TCACGTTTTTATACCCGTACATATG
>probe:Drosophila_2:1628353_at:40:487; Interrogation_Position=746; Antisense; GTAGTATTTATATTCACGTTCACAA
>probe:Drosophila_2:1628353_at:289:721; Interrogation_Position=778; Antisense; TTCCAAATTCGCCTGTCTCCAAAGA

Paste this into a BLAST search page for me
CGCGCCATCCAGGTGTATTTGGTGGAGTACGGCAAGACCGACTCCCTGTATAAGTGCCCCAAGAAGCGCGCCGTGACATGGGAACGCTGTACCAGAGCTTTACTACCCACAGGTGTTCGCCAAGGCCTTCAAGAAGATCGAGGCCGCCTTCGAGTTCCTGAACACCTTCCTGGAGTTACCGTAGCCGACATTGCCCTGGTGGCAACCGTGTCCACATTCGAGGTGAGCAAGTACGCCAATGTGAACAGGTAACTGGGCCGGATGCCTGGAGTTCATCACGTTTTTATACCCGTACATATGGTAGTATTTATATTCACGTTCACAATTCCAAATTCGCCTGTCTCCAAAGA

Full Affymetrix probeset data:

Annotations for 1628353_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720