Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628355_at:

>probe:Drosophila_2:1628355_at:213:685; Interrogation_Position=1454; Antisense; TTTAATTCACCCAGCGACTTTCCGG
>probe:Drosophila_2:1628355_at:148:403; Interrogation_Position=1469; Antisense; GACTTTCCGGATACCTATCAGGACA
>probe:Drosophila_2:1628355_at:431:531; Interrogation_Position=1513; Antisense; GGGTGCCAAGGCGATCATTTACTCA
>probe:Drosophila_2:1628355_at:659:687; Interrogation_Position=1578; Antisense; TATATCCAACATCCGGCGATACGAC
>probe:Drosophila_2:1628355_at:540:287; Interrogation_Position=1591; Antisense; CGGCGATACGACAGACTTTGCGTTT
>probe:Drosophila_2:1628355_at:393:615; Interrogation_Position=1623; Antisense; TGAATGCCACAGTTGCCATGACCAT
>probe:Drosophila_2:1628355_at:304:269; Interrogation_Position=1639; Antisense; CATGACCATGGAGCTGCCGGCTGCA
>probe:Drosophila_2:1628355_at:131:289; Interrogation_Position=1656; Antisense; CGGCTGCAGGTTTCCAGGGATTCGA
>probe:Drosophila_2:1628355_at:476:461; Interrogation_Position=1674; Antisense; GATTCGATCCCTGGATTTCCCAAAT
>probe:Drosophila_2:1628355_at:675:165; Interrogation_Position=1695; Antisense; AAATCGAGCGATTGGTCACGGAAAG
>probe:Drosophila_2:1628355_at:590:577; Interrogation_Position=1741; Antisense; GGCCGCAGAGGTGATAAGACGCTAT
>probe:Drosophila_2:1628355_at:334:341; Interrogation_Position=1761; Antisense; GCTATCCGTCGTAATCGGGCTGTAA
>probe:Drosophila_2:1628355_at:131:403; Interrogation_Position=1793; Antisense; GACATTAGCGTCGAGTTGCGCCAGC
>probe:Drosophila_2:1628355_at:284:263; Interrogation_Position=1814; Antisense; CAGCTCTGATTTGCGGGTCACTCGT

Paste this into a BLAST search page for me
TTTAATTCACCCAGCGACTTTCCGGGACTTTCCGGATACCTATCAGGACAGGGTGCCAAGGCGATCATTTACTCATATATCCAACATCCGGCGATACGACCGGCGATACGACAGACTTTGCGTTTTGAATGCCACAGTTGCCATGACCATCATGACCATGGAGCTGCCGGCTGCACGGCTGCAGGTTTCCAGGGATTCGAGATTCGATCCCTGGATTTCCCAAATAAATCGAGCGATTGGTCACGGAAAGGGCCGCAGAGGTGATAAGACGCTATGCTATCCGTCGTAATCGGGCTGTAAGACATTAGCGTCGAGTTGCGCCAGCCAGCTCTGATTTGCGGGTCACTCGT

Full Affymetrix probeset data:

Annotations for 1628355_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime