FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628357_at:

>probe:Drosophila_2:1628357_at:389:523; Interrogation_Position=1290; Antisense; GGGCATCACCGACGAGTTTTACGAC
>probe:Drosophila_2:1628357_at:521:423; Interrogation_Position=1342; Antisense; GAGACCTTTGGTCTGGTTCCAGTGC
>probe:Drosophila_2:1628357_at:480:351; Interrogation_Position=1388; Antisense; GCAGAATATCGCTGCGCAGTCGCAA
>probe:Drosophila_2:1628357_at:683:65; Interrogation_Position=1432; Antisense; ATGGAACCCAATTTCATGCAGCACC
>probe:Drosophila_2:1628357_at:124:99; Interrogation_Position=1529; Antisense; AGATGGGTACTCGTTTCCATGACCG
>probe:Drosophila_2:1628357_at:316:423; Interrogation_Position=1570; Antisense; GAGAACCTGAAATTCGCCAGCGAGG
>probe:Drosophila_2:1628357_at:157:295; Interrogation_Position=1590; Antisense; CGAGGCGTACTGGAAATGCTGCTTA
>probe:Drosophila_2:1628357_at:343:215; Interrogation_Position=1617; Antisense; AAGATATGGCTCCAGCTTGCAGCAT
>probe:Drosophila_2:1628357_at:5:29; Interrogation_Position=1679; Antisense; ATACTTCAGTGGTGGATGCCCAACT
>probe:Drosophila_2:1628357_at:355:467; Interrogation_Position=1732; Antisense; GTTGTTGATGCTTCTGTGTTACCTA
>probe:Drosophila_2:1628357_at:319:601; Interrogation_Position=1748; Antisense; TGTTACCTAATGTCCCAGCTGGTCA
>probe:Drosophila_2:1628357_at:333:121; Interrogation_Position=1764; Antisense; AGCTGGTCACACCAATGCCATTGTG
>probe:Drosophila_2:1628357_at:114:315; Interrogation_Position=1780; Antisense; GCCATTGTGATCATGGTCGCCGAAA
>probe:Drosophila_2:1628357_at:52:711; Interrogation_Position=1820; Antisense; TTAAGGATGCTTGGCGCATGCCGAT

Paste this into a BLAST search page for me
GGGCATCACCGACGAGTTTTACGACGAGACCTTTGGTCTGGTTCCAGTGCGCAGAATATCGCTGCGCAGTCGCAAATGGAACCCAATTTCATGCAGCACCAGATGGGTACTCGTTTCCATGACCGGAGAACCTGAAATTCGCCAGCGAGGCGAGGCGTACTGGAAATGCTGCTTAAAGATATGGCTCCAGCTTGCAGCATATACTTCAGTGGTGGATGCCCAACTGTTGTTGATGCTTCTGTGTTACCTATGTTACCTAATGTCCCAGCTGGTCAAGCTGGTCACACCAATGCCATTGTGGCCATTGTGATCATGGTCGCCGAAATTAAGGATGCTTGGCGCATGCCGAT

Full Affymetrix probeset data:

Annotations for 1628357_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720