Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628358_at:

>probe:Drosophila_2:1628358_at:124:327; Interrogation_Position=1560; Antisense; GCTGTCGGAAGTGTTGGCGCCAATA
>probe:Drosophila_2:1628358_at:237:687; Interrogation_Position=1587; Antisense; TATAGTACTTATCTGGAGCCGTGCT
>probe:Drosophila_2:1628358_at:261:415; Interrogation_Position=1602; Antisense; GAGCCGTGCTACTATGGCAATGGCC
>probe:Drosophila_2:1628358_at:587:145; Interrogation_Position=1659; Antisense; ACTCGCGTCGGAATGGATCGTCCAA
>probe:Drosophila_2:1628358_at:438:173; Interrogation_Position=1693; Antisense; AAAGCTGCTTTGGTCTCAATGTGGA
>probe:Drosophila_2:1628358_at:675:513; Interrogation_Position=1726; Antisense; GTGTTGTGCTCGAGGATTCATCATC
>probe:Drosophila_2:1628358_at:216:387; Interrogation_Position=1809; Antisense; GAAAACAGTCCTCTAAGTACACCCA
>probe:Drosophila_2:1628358_at:521:213; Interrogation_Position=1851; Antisense; GTAGGAAAAGCCACTAGTCCTCCTA
>probe:Drosophila_2:1628358_at:484:153; Interrogation_Position=1888; Antisense; ACAACAGTAGTAGCCATCCAATTCA
>probe:Drosophila_2:1628358_at:696:449; Interrogation_Position=2015; Antisense; GATCGATGGCATAAGCTCCTTCTAT
>probe:Drosophila_2:1628358_at:89:33; Interrogation_Position=2025; Antisense; ATAAGCTCCTTCTATGGCACCGGAT
>probe:Drosophila_2:1628358_at:681:583; Interrogation_Position=2039; Antisense; TGGCACCGGATCATCGTATCAGCAA
>probe:Drosophila_2:1628358_at:722:511; Interrogation_Position=2069; Antisense; GGTTGCCAACTAGAGTTTCCTCGAA
>probe:Drosophila_2:1628358_at:555:695; Interrogation_Position=2084; Antisense; TTTCCTCGAAGTCAATCACCGCAAA

Paste this into a BLAST search page for me
GCTGTCGGAAGTGTTGGCGCCAATATATAGTACTTATCTGGAGCCGTGCTGAGCCGTGCTACTATGGCAATGGCCACTCGCGTCGGAATGGATCGTCCAAAAAGCTGCTTTGGTCTCAATGTGGAGTGTTGTGCTCGAGGATTCATCATCGAAAACAGTCCTCTAAGTACACCCAGTAGGAAAAGCCACTAGTCCTCCTAACAACAGTAGTAGCCATCCAATTCAGATCGATGGCATAAGCTCCTTCTATATAAGCTCCTTCTATGGCACCGGATTGGCACCGGATCATCGTATCAGCAAGGTTGCCAACTAGAGTTTCCTCGAATTTCCTCGAAGTCAATCACCGCAAA

Full Affymetrix probeset data:

Annotations for 1628358_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime