Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628360_at:

>probe:Drosophila_2:1628360_at:429:683; Interrogation_Position=12601; Antisense; TATCCGTCGCTTAAGCCATTGGGCA
>probe:Drosophila_2:1628360_at:313:5; Interrogation_Position=12618; Antisense; ATTGGGCAGCTACGTGAGCGACCTT
>probe:Drosophila_2:1628360_at:72:729; Interrogation_Position=12699; Antisense; TTGGATATCTGGCTTCTACTTCACC
>probe:Drosophila_2:1628360_at:675:33; Interrogation_Position=12733; Antisense; ATCACGGGCGTCCTGCAGAACTATT
>probe:Drosophila_2:1628360_at:565:689; Interrogation_Position=12754; Antisense; TATTCGCGCAAGAATCGCTTCCAAA
>probe:Drosophila_2:1628360_at:466:691; Interrogation_Position=12788; Antisense; TATTGATCGAGTTCGCGGTGACCAA
>probe:Drosophila_2:1628360_at:440:569; Interrogation_Position=12862; Antisense; GGCATTTTTATCGAGGGCGCACGCT
>probe:Drosophila_2:1628360_at:414:371; Interrogation_Position=12924; Antisense; GAAGGTACTGTTCGATACACTGCCT
>probe:Drosophila_2:1628360_at:407:665; Interrogation_Position=12939; Antisense; TACACTGCCTGTTATTTACCTGCGA
>probe:Drosophila_2:1628360_at:16:623; Interrogation_Position=12968; Antisense; TGCTGAAGGCCCTGGAGGATCTACC
>probe:Drosophila_2:1628360_at:49:611; Interrogation_Position=13011; Antisense; TGAGCCGGAGACCATCTACGACTGT
>probe:Drosophila_2:1628360_at:272:405; Interrogation_Position=13030; Antisense; GACTGTCCCGTTTATAAGACCAGCG
>probe:Drosophila_2:1628360_at:100:245; Interrogation_Position=13093; Antisense; AATTTCGTGATGTACCTGCAGCTGA
>probe:Drosophila_2:1628360_at:537:603; Interrogation_Position=13120; Antisense; TGTTCCCGGAAACCCATGCATTGGA

Paste this into a BLAST search page for me
TATCCGTCGCTTAAGCCATTGGGCAATTGGGCAGCTACGTGAGCGACCTTTTGGATATCTGGCTTCTACTTCACCATCACGGGCGTCCTGCAGAACTATTTATTCGCGCAAGAATCGCTTCCAAATATTGATCGAGTTCGCGGTGACCAAGGCATTTTTATCGAGGGCGCACGCTGAAGGTACTGTTCGATACACTGCCTTACACTGCCTGTTATTTACCTGCGATGCTGAAGGCCCTGGAGGATCTACCTGAGCCGGAGACCATCTACGACTGTGACTGTCCCGTTTATAAGACCAGCGAATTTCGTGATGTACCTGCAGCTGATGTTCCCGGAAACCCATGCATTGGA

Full Affymetrix probeset data:

Annotations for 1628360_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime