FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628364_at:

>probe:Drosophila_2:1628364_at:397:471; Interrogation_Position=312; Antisense; GTTCGACATGAACTTCCCCAAGATT
>probe:Drosophila_2:1628364_at:458:29; Interrogation_Position=356; Antisense; ATAAACTAAATCTCCTGGCTCGTCT
>probe:Drosophila_2:1628364_at:651:569; Interrogation_Position=372; Antisense; GGCTCGTCTATTTGGTGCCGATTTC
>probe:Drosophila_2:1628364_at:6:507; Interrogation_Position=413; Antisense; GTGCCCTCAGTCTGGAGTTGATCAA
>probe:Drosophila_2:1628364_at:576:243; Interrogation_Position=436; Antisense; AATTTCCGAGCTTACGGCAGTTTCG
>probe:Drosophila_2:1628364_at:4:569; Interrogation_Position=451; Antisense; GGCAGTTTCGTTATTCGCCCAAAGT
>probe:Drosophila_2:1628364_at:74:311; Interrogation_Position=478; Antisense; GCCACCAGTGGTGTGTACGCCAAGA
>probe:Drosophila_2:1628364_at:351:435; Interrogation_Position=526; Antisense; GAGGAGGCTAAGTCCCAGACCACGG
>probe:Drosophila_2:1628364_at:50:647; Interrogation_Position=650; Antisense; TCATGGAGGAGCTCATTGTTCCGCC
>probe:Drosophila_2:1628364_at:405:727; Interrogation_Position=665; Antisense; TTGTTCCGCCCATGAATTTGGTTCT
>probe:Drosophila_2:1628364_at:561:541; Interrogation_Position=684; Antisense; GGTTCTGGATAATCTGGCCTGGTAT
>probe:Drosophila_2:1628364_at:573:13; Interrogation_Position=712; Antisense; ATTACCGCTATCATTTTGGGCCTGG
>probe:Drosophila_2:1628364_at:486:565; Interrogation_Position=742; Antisense; GGAATTTTGCCGGTGGAGCCAATTT
>probe:Drosophila_2:1628364_at:380:79; Interrogation_Position=794; Antisense; AGGTGTTCCCTGTGCTTAAATGTAA

Paste this into a BLAST search page for me
GTTCGACATGAACTTCCCCAAGATTATAAACTAAATCTCCTGGCTCGTCTGGCTCGTCTATTTGGTGCCGATTTCGTGCCCTCAGTCTGGAGTTGATCAAAATTTCCGAGCTTACGGCAGTTTCGGGCAGTTTCGTTATTCGCCCAAAGTGCCACCAGTGGTGTGTACGCCAAGAGAGGAGGCTAAGTCCCAGACCACGGTCATGGAGGAGCTCATTGTTCCGCCTTGTTCCGCCCATGAATTTGGTTCTGGTTCTGGATAATCTGGCCTGGTATATTACCGCTATCATTTTGGGCCTGGGGAATTTTGCCGGTGGAGCCAATTTAGGTGTTCCCTGTGCTTAAATGTAA

Full Affymetrix probeset data:

Annotations for 1628364_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720