FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628365_at:

>probe:Drosophila_2:1628365_at:658:49; Interrogation_Position=1014; Antisense; ATGCCTGCAATCCACAATGAGTCAA
>probe:Drosophila_2:1628365_at:259:231; Interrogation_Position=1029; Antisense; AATGAGTCAATCTCTGGCGCACGAT
>probe:Drosophila_2:1628365_at:509:359; Interrogation_Position=1195; Antisense; GCAAGCCAGCCATCCGATGTTTTAG
>probe:Drosophila_2:1628365_at:233:313; Interrogation_Position=1226; Antisense; GCCAGAGCGCACTTAATTATGATTT
>probe:Drosophila_2:1628365_at:90:661; Interrogation_Position=1273; Antisense; TAAAACTAATCGAATACCCGCGCCG
>probe:Drosophila_2:1628365_at:355:727; Interrogation_Position=1316; Antisense; TTGGTTCGCGTGAGCATGCACATTT
>probe:Drosophila_2:1628365_at:563:205; Interrogation_Position=773; Antisense; AAGCGAATGATCCTGAGACCCCGAA
>probe:Drosophila_2:1628365_at:243:645; Interrogation_Position=807; Antisense; TCTTTCCGGGAATAGCAGCAGCACT
>probe:Drosophila_2:1628365_at:47:353; Interrogation_Position=821; Antisense; GCAGCAGCACTTCTGTGACAGACGT
>probe:Drosophila_2:1628365_at:323:549; Interrogation_Position=870; Antisense; GGAGGGAGGATCTCAACCTTCAATT
>probe:Drosophila_2:1628365_at:356:161; Interrogation_Position=903; Antisense; AAATTGTCGCGCTGTGCCCATCGGT
>probe:Drosophila_2:1628365_at:75:529; Interrogation_Position=931; Antisense; GGGATTAGGCCAGCTTACCATACCT
>probe:Drosophila_2:1628365_at:473:421; Interrogation_Position=976; Antisense; GAGAATGCCTCCGTGGTCGGACTAT
>probe:Drosophila_2:1628365_at:695:63; Interrogation_Position=999; Antisense; ATGTGGCAGTCCCTTATGCCTGCAA

Paste this into a BLAST search page for me
ATGCCTGCAATCCACAATGAGTCAAAATGAGTCAATCTCTGGCGCACGATGCAAGCCAGCCATCCGATGTTTTAGGCCAGAGCGCACTTAATTATGATTTTAAAACTAATCGAATACCCGCGCCGTTGGTTCGCGTGAGCATGCACATTTAAGCGAATGATCCTGAGACCCCGAATCTTTCCGGGAATAGCAGCAGCACTGCAGCAGCACTTCTGTGACAGACGTGGAGGGAGGATCTCAACCTTCAATTAAATTGTCGCGCTGTGCCCATCGGTGGGATTAGGCCAGCTTACCATACCTGAGAATGCCTCCGTGGTCGGACTATATGTGGCAGTCCCTTATGCCTGCAA

Full Affymetrix probeset data:

Annotations for 1628365_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720