FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628366_at:

>probe:Drosophila_2:1628366_at:509:53; Interrogation_Position=1025; Antisense; ATGAAGTGTCCGAAATCCGCGTGGC
>probe:Drosophila_2:1628366_at:397:233; Interrogation_Position=1038; Antisense; AATCCGCGTGGCCTTGGTTGAACTG
>probe:Drosophila_2:1628366_at:435:127; Interrogation_Position=1076; Antisense; ACGTTCGTCGCGTAACCAAGACTAT
>probe:Drosophila_2:1628366_at:316:29; Interrogation_Position=1099; Antisense; ATACTGGACTTCTTGATTTCCCTTG
>probe:Drosophila_2:1628366_at:357:555; Interrogation_Position=1126; Antisense; GGACTGGTTGGCCTGTTCTTCAACA
>probe:Drosophila_2:1628366_at:50:303; Interrogation_Position=1154; Antisense; CCGCCTTGCGAATAGTGGAGACCAT
>probe:Drosophila_2:1628366_at:449:127; Interrogation_Position=1174; Antisense; ACCATTGTTATCTGTCTGCGGTACA
>probe:Drosophila_2:1628366_at:51:121; Interrogation_Position=1223; Antisense; AGCGGTTTTTTCTTGGCACAGTTCA
>probe:Drosophila_2:1628366_at:179:665; Interrogation_Position=1253; Antisense; TACAGATCTTGGACCAGTCGACCTT
>probe:Drosophila_2:1628366_at:662:525; Interrogation_Position=756; Antisense; GGGAATCTACGACTTCTACAGCTAC
>probe:Drosophila_2:1628366_at:146:533; Interrogation_Position=792; Antisense; GGTGGAGTGTACTGTGCTACTTCAA
>probe:Drosophila_2:1628366_at:13:341; Interrogation_Position=807; Antisense; GCTACTTCAACTGGACAACTGCAAC
>probe:Drosophila_2:1628366_at:532:245; Interrogation_Position=865; Antisense; AATTATCTGCCCGTTTGTGACGTTC
>probe:Drosophila_2:1628366_at:711:219; Interrogation_Position=940; Antisense; AAGTCCTGCGAGTGCATGAGCTCCT

Paste this into a BLAST search page for me
ATGAAGTGTCCGAAATCCGCGTGGCAATCCGCGTGGCCTTGGTTGAACTGACGTTCGTCGCGTAACCAAGACTATATACTGGACTTCTTGATTTCCCTTGGGACTGGTTGGCCTGTTCTTCAACACCGCCTTGCGAATAGTGGAGACCATACCATTGTTATCTGTCTGCGGTACAAGCGGTTTTTTCTTGGCACAGTTCATACAGATCTTGGACCAGTCGACCTTGGGAATCTACGACTTCTACAGCTACGGTGGAGTGTACTGTGCTACTTCAAGCTACTTCAACTGGACAACTGCAACAATTATCTGCCCGTTTGTGACGTTCAAGTCCTGCGAGTGCATGAGCTCCT

Full Affymetrix probeset data:

Annotations for 1628366_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720