FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628368_at:

>probe:Drosophila_2:1628368_at:506:703; Interrogation_Position=3260; Antisense; TTATTATCTCTCTTTTTCAAAACGA
>probe:Drosophila_2:1628368_at:394:689; Interrogation_Position=3323; Antisense; TATTGAGGCCTTTTTAGACAAACTA
>probe:Drosophila_2:1628368_at:637:481; Interrogation_Position=3396; Antisense; GTATTCAAAGAGAAGCAGCGCCTCA
>probe:Drosophila_2:1628368_at:309:113; Interrogation_Position=3409; Antisense; AGCAGCGCCTCAACTTTAAATCTAG
>probe:Drosophila_2:1628368_at:458:151; Interrogation_Position=3511; Antisense; ACACTCTGTATATAAGCACTCGCCC
>probe:Drosophila_2:1628368_at:635:355; Interrogation_Position=3526; Antisense; GCACTCGCCCCTAATTTGTATTGTA
>probe:Drosophila_2:1628368_at:35:153; Interrogation_Position=3550; Antisense; ACATGATTCTTTTTCTACTTTTTTG
>probe:Drosophila_2:1628368_at:9:727; Interrogation_Position=3572; Antisense; TTGTGTTATCTCCTTACCATTTTAT
>probe:Drosophila_2:1628368_at:141:703; Interrogation_Position=3593; Antisense; TTATATTTCTATCGGTTATGGCAAC
>probe:Drosophila_2:1628368_at:228:699; Interrogation_Position=3623; Antisense; TTTAACATTTATACACTCGCACCCA
>probe:Drosophila_2:1628368_at:463:259; Interrogation_Position=3636; Antisense; CACTCGCACCCACATCAAAATGTAA
>probe:Drosophila_2:1628368_at:700:491; Interrogation_Position=3657; Antisense; GTAACAGCGCATGGATTTCAAAATA
>probe:Drosophila_2:1628368_at:289:541; Interrogation_Position=3694; Antisense; GGAAATTTGGTGTGCGTGTTTGAAA
>probe:Drosophila_2:1628368_at:474:21; Interrogation_Position=3742; Antisense; ATATATAGCCACCAAACGCAGTGTA

Paste this into a BLAST search page for me
TTATTATCTCTCTTTTTCAAAACGATATTGAGGCCTTTTTAGACAAACTAGTATTCAAAGAGAAGCAGCGCCTCAAGCAGCGCCTCAACTTTAAATCTAGACACTCTGTATATAAGCACTCGCCCGCACTCGCCCCTAATTTGTATTGTAACATGATTCTTTTTCTACTTTTTTGTTGTGTTATCTCCTTACCATTTTATTTATATTTCTATCGGTTATGGCAACTTTAACATTTATACACTCGCACCCACACTCGCACCCACATCAAAATGTAAGTAACAGCGCATGGATTTCAAAATAGGAAATTTGGTGTGCGTGTTTGAAAATATATAGCCACCAAACGCAGTGTA

Full Affymetrix probeset data:

Annotations for 1628368_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720