FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628369_at:

>probe:Drosophila_2:1628369_at:304:81; Interrogation_Position=2441; Antisense; AGGGATGCGGCCATTCCATTGGGAT
>probe:Drosophila_2:1628369_at:385:9; Interrogation_Position=2453; Antisense; ATTCCATTGGGATTGCAGGCCTCTG
>probe:Drosophila_2:1628369_at:216:593; Interrogation_Position=2490; Antisense; TGGTGGGCATTCTGATACCACGCAC
>probe:Drosophila_2:1628369_at:690:43; Interrogation_Position=2534; Antisense; ATCGAGCGGTCGGATATTGCCCAAG
>probe:Drosophila_2:1628369_at:162:387; Interrogation_Position=2593; Antisense; GAACAATCAATACTCCTCGGAACAG
>probe:Drosophila_2:1628369_at:187:477; Interrogation_Position=2621; Antisense; GTTTACGAGTGCGTGAATCCCGCCA
>probe:Drosophila_2:1628369_at:255:51; Interrogation_Position=2645; Antisense; ATGCGCCATTGTTCCCAGGATGAGG
>probe:Drosophila_2:1628369_at:630:53; Interrogation_Position=2664; Antisense; ATGAGGTGAACCACCAGTCGCCTAG
>probe:Drosophila_2:1628369_at:260:85; Interrogation_Position=2679; Antisense; AGTCGCCTAGTGAGATTCCCACGTT
>probe:Drosophila_2:1628369_at:518:49; Interrogation_Position=2763; Antisense; ATGCCAACATTAATCCACAACGTCC
>probe:Drosophila_2:1628369_at:240:31; Interrogation_Position=2850; Antisense; ATCACAACAAGATCACCCGGTTTTA
>probe:Drosophila_2:1628369_at:362:287; Interrogation_Position=2867; Antisense; CGGTTTTAGCCCACGAGTGTACAAT
>probe:Drosophila_2:1628369_at:726:229; Interrogation_Position=2889; Antisense; AATGTGGCACTTCTAGTCAACGCTC
>probe:Drosophila_2:1628369_at:77:201; Interrogation_Position=2907; Antisense; AACGCTCCCAGTACGTGAATTCAGC

Paste this into a BLAST search page for me
AGGGATGCGGCCATTCCATTGGGATATTCCATTGGGATTGCAGGCCTCTGTGGTGGGCATTCTGATACCACGCACATCGAGCGGTCGGATATTGCCCAAGGAACAATCAATACTCCTCGGAACAGGTTTACGAGTGCGTGAATCCCGCCAATGCGCCATTGTTCCCAGGATGAGGATGAGGTGAACCACCAGTCGCCTAGAGTCGCCTAGTGAGATTCCCACGTTATGCCAACATTAATCCACAACGTCCATCACAACAAGATCACCCGGTTTTACGGTTTTAGCCCACGAGTGTACAATAATGTGGCACTTCTAGTCAACGCTCAACGCTCCCAGTACGTGAATTCAGC

Full Affymetrix probeset data:

Annotations for 1628369_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720