Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628371_at:

>probe:Drosophila_2:1628371_at:260:697; Interrogation_Position=1025; Antisense; TTTTTCCTTGCCACTGTTGAAAGAC
>probe:Drosophila_2:1628371_at:332:255; Interrogation_Position=1049; Antisense; CAAATGCCCGTCGTTTCGTTTCGAT
>probe:Drosophila_2:1628371_at:62:599; Interrogation_Position=1117; Antisense; TGTAAAGCCACGATTTAACCTAAGG
>probe:Drosophila_2:1628371_at:169:661; Interrogation_Position=1143; Antisense; TAAAATATGCCCGTACTAAATGTAG
>probe:Drosophila_2:1628371_at:537:173; Interrogation_Position=1271; Antisense; AAAGCAGTGCTTAATCCTCGGAGTA
>probe:Drosophila_2:1628371_at:257:45; Interrogation_Position=1284; Antisense; ATCCTCGGAGTAAACCTTGATCATG
>probe:Drosophila_2:1628371_at:397:47; Interrogation_Position=1360; Antisense; ATCCATTTTTTGTCTAGCCTTTAAG
>probe:Drosophila_2:1628371_at:654:17; Interrogation_Position=840; Antisense; ATTTCACCATGCTCTGTAATCCGCA
>probe:Drosophila_2:1628371_at:478:655; Interrogation_Position=856; Antisense; TAATCCGCACATCGCTCCATTGGAT
>probe:Drosophila_2:1628371_at:220:273; Interrogation_Position=873; Antisense; CATTGGATACTTTGCCGGTGGCGGC
>probe:Drosophila_2:1628371_at:456:521; Interrogation_Position=890; Antisense; GTGGCGGCTATGGATAATGCGATTA
>probe:Drosophila_2:1628371_at:513:683; Interrogation_Position=913; Antisense; TATCGAATTAGCCATCTCACCAACT
>probe:Drosophila_2:1628371_at:271:373; Interrogation_Position=943; Antisense; GAAGTGTTCGATGGATTTTGCCGAT
>probe:Drosophila_2:1628371_at:302:693; Interrogation_Position=959; Antisense; TTTGCCGATTTGCTAACCTATTTAA

Paste this into a BLAST search page for me
TTTTTCCTTGCCACTGTTGAAAGACCAAATGCCCGTCGTTTCGTTTCGATTGTAAAGCCACGATTTAACCTAAGGTAAAATATGCCCGTACTAAATGTAGAAAGCAGTGCTTAATCCTCGGAGTAATCCTCGGAGTAAACCTTGATCATGATCCATTTTTTGTCTAGCCTTTAAGATTTCACCATGCTCTGTAATCCGCATAATCCGCACATCGCTCCATTGGATCATTGGATACTTTGCCGGTGGCGGCGTGGCGGCTATGGATAATGCGATTATATCGAATTAGCCATCTCACCAACTGAAGTGTTCGATGGATTTTGCCGATTTTGCCGATTTGCTAACCTATTTAA

Full Affymetrix probeset data:

Annotations for 1628371_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime