FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628373_at:

>probe:Drosophila_2:1628373_at:296:505; Interrogation_Position=2465; Antisense; GTCCAGCCTGATCCAGCTGAGGCAT
>probe:Drosophila_2:1628373_at:292:75; Interrogation_Position=2494; Antisense; AGGAGCTGGAACTGACCAACTGCCC
>probe:Drosophila_2:1628373_at:180:355; Interrogation_Position=2528; Antisense; GCACGAGCTGTTTGACTACCTGAAG
>probe:Drosophila_2:1628373_at:522:443; Interrogation_Position=2598; Antisense; GATGATCGGATACGGAACCCCTGAG
>probe:Drosophila_2:1628373_at:266:201; Interrogation_Position=2613; Antisense; AACCCCTGAGCACTGATTTTCGATT
>probe:Drosophila_2:1628373_at:588:507; Interrogation_Position=2662; Antisense; GTGCGATGCGGCGAACCATTTGAGT
>probe:Drosophila_2:1628373_at:577:651; Interrogation_Position=2691; Antisense; TAATTTGGTACACCTAACCTCCAGT
>probe:Drosophila_2:1628373_at:141:89; Interrogation_Position=2713; Antisense; AGTCGGCAAGTTCCTCGCGTGCTAT
>probe:Drosophila_2:1628373_at:463:327; Interrogation_Position=2729; Antisense; GCGTGCTATGTGACTTTAACTTTCC
>probe:Drosophila_2:1628373_at:591:707; Interrogation_Position=2744; Antisense; TTAACTTTCCGTCAACACTGTACTC
>probe:Drosophila_2:1628373_at:258:651; Interrogation_Position=2755; Antisense; TCAACACTGTACTCTATCCCTTATA
>probe:Drosophila_2:1628373_at:5:461; Interrogation_Position=2796; Antisense; GATTTCTGCTGTGATTTGATACGGA
>probe:Drosophila_2:1628373_at:470:441; Interrogation_Position=2851; Antisense; GATGTACCACAAAAGACCCGAAGAT
>probe:Drosophila_2:1628373_at:265:139; Interrogation_Position=2979; Antisense; ACGTTTTATTTACTACTCTCGCTGT

Paste this into a BLAST search page for me
GTCCAGCCTGATCCAGCTGAGGCATAGGAGCTGGAACTGACCAACTGCCCGCACGAGCTGTTTGACTACCTGAAGGATGATCGGATACGGAACCCCTGAGAACCCCTGAGCACTGATTTTCGATTGTGCGATGCGGCGAACCATTTGAGTTAATTTGGTACACCTAACCTCCAGTAGTCGGCAAGTTCCTCGCGTGCTATGCGTGCTATGTGACTTTAACTTTCCTTAACTTTCCGTCAACACTGTACTCTCAACACTGTACTCTATCCCTTATAGATTTCTGCTGTGATTTGATACGGAGATGTACCACAAAAGACCCGAAGATACGTTTTATTTACTACTCTCGCTGT

Full Affymetrix probeset data:

Annotations for 1628373_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720