FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628374_at:

>probe:Drosophila_2:1628374_at:489:645; Interrogation_Position=1046; Antisense; TCTTCTGCAGTCATCGCAGGCTTAA
>probe:Drosophila_2:1628374_at:579:217; Interrogation_Position=1070; Antisense; AAGTTTGCCATCTGGGATTGCTCGA
>probe:Drosophila_2:1628374_at:715:441; Interrogation_Position=1107; Antisense; GATGGGCTTCCGCATGATAATCACC
>probe:Drosophila_2:1628374_at:15:241; Interrogation_Position=630; Antisense; AATCAATGGCCAACTCCTGGACATG
>probe:Drosophila_2:1628374_at:94:587; Interrogation_Position=647; Antisense; TGGACATGGCCAGTCGTCTGAGAAG
>probe:Drosophila_2:1628374_at:571:651; Interrogation_Position=678; Antisense; TAGCGTAGATCCTGACCGAATCCAA
>probe:Drosophila_2:1628374_at:306:245; Interrogation_Position=701; Antisense; AATTGCTGCTGTGGCTATATTCCCG
>probe:Drosophila_2:1628374_at:154:689; Interrogation_Position=716; Antisense; TATATTCCCGCCTTTTGGACTTGAA
>probe:Drosophila_2:1628374_at:328:77; Interrogation_Position=770; Antisense; AGGTTACACTTTTCATGGCCACCTT
>probe:Drosophila_2:1628374_at:145:313; Interrogation_Position=787; Antisense; GCCACCTTGTTTTCGGTCAACATTA
>probe:Drosophila_2:1628374_at:132:15; Interrogation_Position=808; Antisense; ATTATTGTGGGCCATGTGCTGGTCA
>probe:Drosophila_2:1628374_at:668:507; Interrogation_Position=823; Antisense; GTGCTGGTCATTTGCTGGATCAACA
>probe:Drosophila_2:1628374_at:472:459; Interrogation_Position=854; Antisense; GATTTTCCCTGCTGGTTATATTCCT
>probe:Drosophila_2:1628374_at:57:339; Interrogation_Position=879; Antisense; GCTCTTTCCCCAAGCTTTGATTATA

Paste this into a BLAST search page for me
TCTTCTGCAGTCATCGCAGGCTTAAAAGTTTGCCATCTGGGATTGCTCGAGATGGGCTTCCGCATGATAATCACCAATCAATGGCCAACTCCTGGACATGTGGACATGGCCAGTCGTCTGAGAAGTAGCGTAGATCCTGACCGAATCCAAAATTGCTGCTGTGGCTATATTCCCGTATATTCCCGCCTTTTGGACTTGAAAGGTTACACTTTTCATGGCCACCTTGCCACCTTGTTTTCGGTCAACATTAATTATTGTGGGCCATGTGCTGGTCAGTGCTGGTCATTTGCTGGATCAACAGATTTTCCCTGCTGGTTATATTCCTGCTCTTTCCCCAAGCTTTGATTATA

Full Affymetrix probeset data:

Annotations for 1628374_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720