Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628376_x_at:

>probe:Drosophila_2:1628376_x_at:425:129; Interrogation_Position=111; Antisense; ACCTCAAGGTGGACCACAGGGCGGA
>probe:Drosophila_2:1628376_x_at:146:51; Interrogation_Position=13; Antisense; ATGCGTTCCTTCATCATCATCGCCC
>probe:Drosophila_2:1628376_x_at:360:409; Interrogation_Position=134; Antisense; GACCCCAGGGTGGACCTCAAGGTGG
>probe:Drosophila_2:1628376_x_at:654:79; Interrogation_Position=153; Antisense; AGGTGGACCCCAGGGTGGTCCTCAG
>probe:Drosophila_2:1628376_x_at:263:629; Interrogation_Position=171; Antisense; TCCTCAGGGAGGACCCCAGGGTGGA
>probe:Drosophila_2:1628376_x_at:58:395; Interrogation_Position=194; Antisense; GACCGCAGGGAGGACCCCAGGGTGG
>probe:Drosophila_2:1628376_x_at:272:147; Interrogation_Position=304; Antisense; ACTTCAACGACCACCGAATCCAGCA
>probe:Drosophila_2:1628376_x_at:25:129; Interrogation_Position=328; Antisense; ACCAGCACAACCACGGAAGCCAGCA
>probe:Drosophila_2:1628376_x_at:587:137; Interrogation_Position=340; Antisense; ACGGAAGCCAGCACCGAGTCATCCC
>probe:Drosophila_2:1628376_x_at:630:717; Interrogation_Position=40; Antisense; TTCGCACTGATTGCCGTGGCTGCCG
>probe:Drosophila_2:1628376_x_at:626:7; Interrogation_Position=49; Antisense; ATTGCCGTGGCTGCCGCTCAAGGTG
>probe:Drosophila_2:1628376_x_at:214:291; Interrogation_Position=54; Antisense; CGTGGCTGCCGCTCAAGGTGGACCC
>probe:Drosophila_2:1628376_x_at:335:83; Interrogation_Position=80; Antisense; AGGGCGGACCTCAGGGTGGACCTCA
>probe:Drosophila_2:1628376_x_at:424:585; Interrogation_Position=96; Antisense; TGGACCTCAGGGTGGACCTCAAGGT

Paste this into a BLAST search page for me
ACCTCAAGGTGGACCACAGGGCGGAATGCGTTCCTTCATCATCATCGCCCGACCCCAGGGTGGACCTCAAGGTGGAGGTGGACCCCAGGGTGGTCCTCAGTCCTCAGGGAGGACCCCAGGGTGGAGACCGCAGGGAGGACCCCAGGGTGGACTTCAACGACCACCGAATCCAGCAACCAGCACAACCACGGAAGCCAGCAACGGAAGCCAGCACCGAGTCATCCCTTCGCACTGATTGCCGTGGCTGCCGATTGCCGTGGCTGCCGCTCAAGGTGCGTGGCTGCCGCTCAAGGTGGACCCAGGGCGGACCTCAGGGTGGACCTCATGGACCTCAGGGTGGACCTCAAGGT

Full Affymetrix probeset data:

Annotations for 1628376_x_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime