FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628379_at:

>probe:Drosophila_2:1628379_at:458:369; Interrogation_Position=1018; Antisense; GAAGGCTCTAAATGGTATGCTACCC
>probe:Drosophila_2:1628379_at:477:539; Interrogation_Position=1031; Antisense; GGTATGCTACCCATTTTGAAGGAGA
>probe:Drosophila_2:1628379_at:136:417; Interrogation_Position=600; Antisense; GAGCCCAGACCTTTGTAGCGGACAT
>probe:Drosophila_2:1628379_at:410:485; Interrogation_Position=614; Antisense; GTAGCGGACATTCTCAACGTTGATC
>probe:Drosophila_2:1628379_at:587:197; Interrogation_Position=629; Antisense; AACGTTGATCCCCAGAAAGTGAATA
>probe:Drosophila_2:1628379_at:39:657; Interrogation_Position=660; Antisense; TAATCGGTGGCCATACAGGTCGGAC
>probe:Drosophila_2:1628379_at:475:623; Interrogation_Position=690; Antisense; TGCCCATACTGTCGCAGTGTGATCC
>probe:Drosophila_2:1628379_at:306:225; Interrogation_Position=734; Antisense; AAGGAGCGCGAAGCGTTGATCCAAC
>probe:Drosophila_2:1628379_at:420:655; Interrogation_Position=787; Antisense; TAATGCCAAGGATGGCCTGGGCTCG
>probe:Drosophila_2:1628379_at:6:313; Interrogation_Position=836; Antisense; GCCACTCAGTTTGTAAGCTCGTTGA
>probe:Drosophila_2:1628379_at:475:597; Interrogation_Position=902; Antisense; TGTGCCTATGTGGAGTCTGATGTCA
>probe:Drosophila_2:1628379_at:184:607; Interrogation_Position=919; Antisense; TGATGTCACGGAGGCCCAGTTCTTC
>probe:Drosophila_2:1628379_at:564:665; Interrogation_Position=957; Antisense; TACTGGGACCCCAGGGTGTCAAGGA
>probe:Drosophila_2:1628379_at:275:177; Interrogation_Position=982; Antisense; AAACACAGGATTGCCCGATTTGGAC

Paste this into a BLAST search page for me
GAAGGCTCTAAATGGTATGCTACCCGGTATGCTACCCATTTTGAAGGAGAGAGCCCAGACCTTTGTAGCGGACATGTAGCGGACATTCTCAACGTTGATCAACGTTGATCCCCAGAAAGTGAATATAATCGGTGGCCATACAGGTCGGACTGCCCATACTGTCGCAGTGTGATCCAAGGAGCGCGAAGCGTTGATCCAACTAATGCCAAGGATGGCCTGGGCTCGGCCACTCAGTTTGTAAGCTCGTTGATGTGCCTATGTGGAGTCTGATGTCATGATGTCACGGAGGCCCAGTTCTTCTACTGGGACCCCAGGGTGTCAAGGAAAACACAGGATTGCCCGATTTGGAC

Full Affymetrix probeset data:

Annotations for 1628379_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720