FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628381_at:

>probe:Drosophila_2:1628381_at:98:629; Interrogation_Position=423; Antisense; TCGCGCCTACCACAATTGGGAGGAG
>probe:Drosophila_2:1628381_at:192:701; Interrogation_Position=511; Antisense; TTCTTCCAGTACTACCACTTCGATG
>probe:Drosophila_2:1628381_at:413:149; Interrogation_Position=527; Antisense; ACTTCGATGGTAACCGCAGCTGTGC
>probe:Drosophila_2:1628381_at:608:429; Interrogation_Position=577; Antisense; GAGTTTTGCAATGATGCCGTCATCG
>probe:Drosophila_2:1628381_at:389:101; Interrogation_Position=647; Antisense; AGACCCCGGAGAACCAGTTGACCTG
>probe:Drosophila_2:1628381_at:99:93; Interrogation_Position=662; Antisense; AGTTGACCTGGTGCCATGACGACGA
>probe:Drosophila_2:1628381_at:568:281; Interrogation_Position=689; Antisense; CCAACTTGCTGCAGGACGTAGACCT
>probe:Drosophila_2:1628381_at:21:105; Interrogation_Position=708; Antisense; AGACCTGGTGGTCCTAGCTGCTTCG
>probe:Drosophila_2:1628381_at:3:719; Interrogation_Position=729; Antisense; TTCGCCGGAGGAGTACAAGCACTAT
>probe:Drosophila_2:1628381_at:629:639; Interrogation_Position=769; Antisense; TCGGAGTACGCCAATCTCGACGATG
>probe:Drosophila_2:1628381_at:667:277; Interrogation_Position=798; Antisense; CTACAAGGCCATGCGCATCAAGGTG
>probe:Drosophila_2:1628381_at:495:33; Interrogation_Position=814; Antisense; ATCAAGGTGCTGGAGACCCTGCTGA
>probe:Drosophila_2:1628381_at:384:313; Interrogation_Position=856; Antisense; GCCACTGGAGACTACCACGACAAGT
>probe:Drosophila_2:1628381_at:540:217; Interrogation_Position=877; Antisense; AAGTACGAAGAGCTAGCCCGCGCCA

Paste this into a BLAST search page for me
TCGCGCCTACCACAATTGGGAGGAGTTCTTCCAGTACTACCACTTCGATGACTTCGATGGTAACCGCAGCTGTGCGAGTTTTGCAATGATGCCGTCATCGAGACCCCGGAGAACCAGTTGACCTGAGTTGACCTGGTGCCATGACGACGACCAACTTGCTGCAGGACGTAGACCTAGACCTGGTGGTCCTAGCTGCTTCGTTCGCCGGAGGAGTACAAGCACTATTCGGAGTACGCCAATCTCGACGATGCTACAAGGCCATGCGCATCAAGGTGATCAAGGTGCTGGAGACCCTGCTGAGCCACTGGAGACTACCACGACAAGTAAGTACGAAGAGCTAGCCCGCGCCA

Full Affymetrix probeset data:

Annotations for 1628381_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720