FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628382_at:

>probe:Drosophila_2:1628382_at:111:179; Interrogation_Position=1565; Antisense; AAACTCGCAAACTCAAATCCATCTC
>probe:Drosophila_2:1628382_at:336:235; Interrogation_Position=1580; Antisense; AATCCATCTCTGAGGACACTGAGGT
>probe:Drosophila_2:1628382_at:2:435; Interrogation_Position=1600; Antisense; GAGGTTAAGAGCTCACGATCCAGCG
>probe:Drosophila_2:1628382_at:272:449; Interrogation_Position=1616; Antisense; GATCCAGCGCCGATTCGAAGTCACG
>probe:Drosophila_2:1628382_at:83:217; Interrogation_Position=1633; Antisense; AAGTCACGCAAATCGGTTAGTGTCG
>probe:Drosophila_2:1628382_at:357:559; Interrogation_Position=1665; Antisense; GGACAACATGGACATCTCCAACTCG
>probe:Drosophila_2:1628382_at:60:195; Interrogation_Position=1684; Antisense; AACTCGCCCTAGACCTAGAGAGATT
>probe:Drosophila_2:1628382_at:110:427; Interrogation_Position=1701; Antisense; GAGAGATTGCATACTACTTTATAAT
>probe:Drosophila_2:1628382_at:537:1; Interrogation_Position=1728; Antisense; ATACAGAACTTAAGCAACCCCGTCT
>probe:Drosophila_2:1628382_at:448:295; Interrogation_Position=1764; Antisense; CGACACCCATTGTCCTCAATGAGAT
>probe:Drosophila_2:1628382_at:662:601; Interrogation_Position=1790; Antisense; TGTATTTCACTCAACTCTGTCATAG
>probe:Drosophila_2:1628382_at:549:175; Interrogation_Position=1838; Antisense; AAACTGAAGCATTTTCTTTCGTAAT
>probe:Drosophila_2:1628382_at:652:455; Interrogation_Position=1891; Antisense; GATATCGGTATCATAGCAGTACAAT
>probe:Drosophila_2:1628382_at:62:163; Interrogation_Position=1963; Antisense; ACAATCTTATTGTCTTCTTATTAGG

Paste this into a BLAST search page for me
AAACTCGCAAACTCAAATCCATCTCAATCCATCTCTGAGGACACTGAGGTGAGGTTAAGAGCTCACGATCCAGCGGATCCAGCGCCGATTCGAAGTCACGAAGTCACGCAAATCGGTTAGTGTCGGGACAACATGGACATCTCCAACTCGAACTCGCCCTAGACCTAGAGAGATTGAGAGATTGCATACTACTTTATAATATACAGAACTTAAGCAACCCCGTCTCGACACCCATTGTCCTCAATGAGATTGTATTTCACTCAACTCTGTCATAGAAACTGAAGCATTTTCTTTCGTAATGATATCGGTATCATAGCAGTACAATACAATCTTATTGTCTTCTTATTAGG

Full Affymetrix probeset data:

Annotations for 1628382_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720