FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628386_at:

>probe:Drosophila_2:1628386_at:431:549; Interrogation_Position=100; Antisense; GGAGATTTTACCAACTTTGCCCATG
>probe:Drosophila_2:1628386_at:480:693; Interrogation_Position=115; Antisense; TTTGCCCATGGCATTAAGGGTCAAA
>probe:Drosophila_2:1628386_at:41:709; Interrogation_Position=128; Antisense; TTAAGGGTCAAATCTACGCGGTGGA
>probe:Drosophila_2:1628386_at:27:239; Interrogation_Position=138; Antisense; AATCTACGCGGTGGACGAGTCGACG
>probe:Drosophila_2:1628386_at:503:85; Interrogation_Position=155; Antisense; AGTCGACGCTGTTCGTCAAATCCTT
>probe:Drosophila_2:1628386_at:208:495; Interrogation_Position=169; Antisense; GTCAAATCCTTTGCCTACGACGGCA
>probe:Drosophila_2:1628386_at:371:43; Interrogation_Position=17; Antisense; ATCGCATTGAAATCTCGTTCGTCCG
>probe:Drosophila_2:1628386_at:284:411; Interrogation_Position=202; Antisense; GACGCCTTCTTCTGGGTGGGCAAGA
>probe:Drosophila_2:1628386_at:549:665; Interrogation_Position=250; Antisense; TACATCATTCCCTATCCGGAGGAGT
>probe:Drosophila_2:1628386_at:273:683; Interrogation_Position=262; Antisense; TATCCGGAGGAGTACACGGGCATGT
>probe:Drosophila_2:1628386_at:125:635; Interrogation_Position=42; Antisense; TCGCCTCTGTGTTTCAGCCGGACGA
>probe:Drosophila_2:1628386_at:133:713; Interrogation_Position=54; Antisense; TTCAGCCGGACGAGCTCCACCGGAA
>probe:Drosophila_2:1628386_at:710:559; Interrogation_Position=75; Antisense; GGAACCCTACTACGGTCGCTATATT
>probe:Drosophila_2:1628386_at:365:277; Interrogation_Position=84; Antisense; CTACGGTCGCTATATTGGAGATTTT

Paste this into a BLAST search page for me
GGAGATTTTACCAACTTTGCCCATGTTTGCCCATGGCATTAAGGGTCAAATTAAGGGTCAAATCTACGCGGTGGAAATCTACGCGGTGGACGAGTCGACGAGTCGACGCTGTTCGTCAAATCCTTGTCAAATCCTTTGCCTACGACGGCAATCGCATTGAAATCTCGTTCGTCCGGACGCCTTCTTCTGGGTGGGCAAGATACATCATTCCCTATCCGGAGGAGTTATCCGGAGGAGTACACGGGCATGTTCGCCTCTGTGTTTCAGCCGGACGATTCAGCCGGACGAGCTCCACCGGAAGGAACCCTACTACGGTCGCTATATTCTACGGTCGCTATATTGGAGATTTT

Full Affymetrix probeset data:

Annotations for 1628386_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720