Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628387_s_at:

>probe:Drosophila_2:1628387_s_at:636:47; Interrogation_Position=124; Antisense; ATCCATCCAAGACACGCCATGCAGT
>probe:Drosophila_2:1628387_s_at:669:307; Interrogation_Position=126; Antisense; CCATCCAAGACACGCCATGCAGTAG
>probe:Drosophila_2:1628387_s_at:250:67; Interrogation_Position=13; Antisense; ATGGAGCACATTCGATTTGTTGACA
>probe:Drosophila_2:1628387_s_at:316:421; Interrogation_Position=16; Antisense; GAGCACATTCGATTTGTTGACAAAG
>probe:Drosophila_2:1628387_s_at:48:469; Interrogation_Position=31; Antisense; GTTGACAAAGTCTTTAGAGCCCTGA
>probe:Drosophila_2:1628387_s_at:5:399; Interrogation_Position=34; Antisense; GACAAAGTCTTTAGAGCCCTGATCG
>probe:Drosophila_2:1628387_s_at:511:169; Interrogation_Position=37; Antisense; AAAGTCTTTAGAGCCCTGATCGCCG
>probe:Drosophila_2:1628387_s_at:20:499; Interrogation_Position=40; Antisense; GTCTTTAGAGCCCTGATCGCCGGCA
>probe:Drosophila_2:1628387_s_at:602:621; Interrogation_Position=68; Antisense; TGCTGCTCCTGATGACCGCCATTTA
>probe:Drosophila_2:1628387_s_at:8:607; Interrogation_Position=77; Antisense; TGATGACCGCCATTTACCGGGAGGA
>probe:Drosophila_2:1628387_s_at:25:611; Interrogation_Position=80; Antisense; TGACCGCCATTTACCGGGAGGACAA
>probe:Drosophila_2:1628387_s_at:495:311; Interrogation_Position=85; Antisense; GCCATTTACCGGGAGGACAACAACT
>probe:Drosophila_2:1628387_s_at:505:517; Interrogation_Position=95; Antisense; GGGAGGACAACAACTCCGGATCCCA
>probe:Drosophila_2:1628387_s_at:475:73; Interrogation_Position=98; Antisense; AGGACAACAACTCCGGATCCCACTA

Paste this into a BLAST search page for me
ATCCATCCAAGACACGCCATGCAGTCCATCCAAGACACGCCATGCAGTAGATGGAGCACATTCGATTTGTTGACAGAGCACATTCGATTTGTTGACAAAGGTTGACAAAGTCTTTAGAGCCCTGAGACAAAGTCTTTAGAGCCCTGATCGAAAGTCTTTAGAGCCCTGATCGCCGGTCTTTAGAGCCCTGATCGCCGGCATGCTGCTCCTGATGACCGCCATTTATGATGACCGCCATTTACCGGGAGGATGACCGCCATTTACCGGGAGGACAAGCCATTTACCGGGAGGACAACAACTGGGAGGACAACAACTCCGGATCCCAAGGACAACAACTCCGGATCCCACTA

Full Affymetrix probeset data:

Annotations for 1628387_s_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime