FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628388_at:

>probe:Drosophila_2:1628388_at:176:535; Interrogation_Position=1005; Antisense; GGTCTACGTTCCCTCGAAATTGATT
>probe:Drosophila_2:1628388_at:184:397; Interrogation_Position=1020; Antisense; GAAATTGATTAGTCGCCGTGCGCAC
>probe:Drosophila_2:1628388_at:104:289; Interrogation_Position=1036; Antisense; CGTGCGCACAACTGTACCTTAATTT
>probe:Drosophila_2:1628388_at:195:607; Interrogation_Position=1063; Antisense; TGAGCCTTCAGCGATTTTTACATAT
>probe:Drosophila_2:1628388_at:549:543; Interrogation_Position=1176; Antisense; GGATTAGGCTCGTCTATCTATTGTA
>probe:Drosophila_2:1628388_at:497:691; Interrogation_Position=1194; Antisense; TATTGTATTTTTGCTTTGTTCCCGT
>probe:Drosophila_2:1628388_at:542:571; Interrogation_Position=685; Antisense; GGCTCAAGGAGATCCACGTGCTCAA
>probe:Drosophila_2:1628388_at:73:651; Interrogation_Position=706; Antisense; TCAACTGCCCGTCGTATGTGGACAA
>probe:Drosophila_2:1628388_at:711:513; Interrogation_Position=768; Antisense; GTGTTCAAGCTAATCCATTTCCATT
>probe:Drosophila_2:1628388_at:299:167; Interrogation_Position=797; Antisense; AAATGCGGACACTCCATATCGGCAC
>probe:Drosophila_2:1628388_at:441:303; Interrogation_Position=825; Antisense; CCGCGATCCATGTTGCCGGAGGAAT
>probe:Drosophila_2:1628388_at:646:213; Interrogation_Position=867; Antisense; AAGATGTCCGACCTGAAGCTCCAGT
>probe:Drosophila_2:1628388_at:525:207; Interrogation_Position=882; Antisense; AAGCTCCAGTGGATGCAGTTGCTCA
>probe:Drosophila_2:1628388_at:681:461; Interrogation_Position=987; Antisense; GATTCCGGAGTCACAGAAGGTCTAC

Paste this into a BLAST search page for me
GGTCTACGTTCCCTCGAAATTGATTGAAATTGATTAGTCGCCGTGCGCACCGTGCGCACAACTGTACCTTAATTTTGAGCCTTCAGCGATTTTTACATATGGATTAGGCTCGTCTATCTATTGTATATTGTATTTTTGCTTTGTTCCCGTGGCTCAAGGAGATCCACGTGCTCAATCAACTGCCCGTCGTATGTGGACAAGTGTTCAAGCTAATCCATTTCCATTAAATGCGGACACTCCATATCGGCACCCGCGATCCATGTTGCCGGAGGAATAAGATGTCCGACCTGAAGCTCCAGTAAGCTCCAGTGGATGCAGTTGCTCAGATTCCGGAGTCACAGAAGGTCTAC

Full Affymetrix probeset data:

Annotations for 1628388_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720