FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628389_at:

>probe:Drosophila_2:1628389_at:541:19; Interrogation_Position=2420; Antisense; ATATTCAGGCTGCTTTGGCCAGGGT
>probe:Drosophila_2:1628389_at:726:579; Interrogation_Position=2435; Antisense; TGGCCAGGGTGTGCGCAAATCGTAC
>probe:Drosophila_2:1628389_at:19:357; Interrogation_Position=2449; Antisense; GCAAATCGTACCACCATCATTGTTG
>probe:Drosophila_2:1628389_at:377:37; Interrogation_Position=2464; Antisense; ATCATTGTTGCCCATCGTCTTTCCA
>probe:Drosophila_2:1628389_at:137:137; Interrogation_Position=2504; Antisense; ACGAGATTCTGGTCCTGCAGCAGGG
>probe:Drosophila_2:1628389_at:526:157; Interrogation_Position=2550; Antisense; ACACGAAGAGCTTGTGCTGCGCGAA
>probe:Drosophila_2:1628389_at:652:373; Interrogation_Position=2572; Antisense; GAAGATGGCATCTACGCGGACATGT
>probe:Drosophila_2:1628389_at:161:531; Interrogation_Position=2635; Antisense; GGTGGTTCTGATAACGGAGACGCTA
>probe:Drosophila_2:1628389_at:66:103; Interrogation_Position=2652; Antisense; AGACGCTAGTGCAGAATCGGGATCG
>probe:Drosophila_2:1628389_at:174:487; Interrogation_Position=2714; Antisense; GTACTGGAACGGGTGGTGCCCACTT
>probe:Drosophila_2:1628389_at:288:259; Interrogation_Position=2734; Antisense; CACTTCAGGGCAGGACATGCTCATG
>probe:Drosophila_2:1628389_at:521:135; Interrogation_Position=2766; Antisense; ACGCTAGCCTTAAGTGACATACAGA
>probe:Drosophila_2:1628389_at:393:485; Interrogation_Position=2791; Antisense; GTAGTTTCTGATATTCCTGATTCCA
>probe:Drosophila_2:1628389_at:629:419; Interrogation_Position=2847; Antisense; GAGCAGCTCGTCAAAGTCTTAGTTC

Paste this into a BLAST search page for me
ATATTCAGGCTGCTTTGGCCAGGGTTGGCCAGGGTGTGCGCAAATCGTACGCAAATCGTACCACCATCATTGTTGATCATTGTTGCCCATCGTCTTTCCAACGAGATTCTGGTCCTGCAGCAGGGACACGAAGAGCTTGTGCTGCGCGAAGAAGATGGCATCTACGCGGACATGTGGTGGTTCTGATAACGGAGACGCTAAGACGCTAGTGCAGAATCGGGATCGGTACTGGAACGGGTGGTGCCCACTTCACTTCAGGGCAGGACATGCTCATGACGCTAGCCTTAAGTGACATACAGAGTAGTTTCTGATATTCCTGATTCCAGAGCAGCTCGTCAAAGTCTTAGTTC

Full Affymetrix probeset data:

Annotations for 1628389_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720