FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628396_at:

>probe:Drosophila_2:1628396_at:533:457; Interrogation_Position=2760; Antisense; GATATCCATTCAGAACTCAGCGCAC
>probe:Drosophila_2:1628396_at:678:707; Interrogation_Position=2786; Antisense; TTAAGTGTTTCCATTCCAATACCCA
>probe:Drosophila_2:1628396_at:178:295; Interrogation_Position=2868; Antisense; CGATGAGATTATCCGCCAGCACAAG
>probe:Drosophila_2:1628396_at:668:225; Interrogation_Position=2890; Antisense; AAGGCGGCTTGTCTGCGAGTAACAT
>probe:Drosophila_2:1628396_at:702:189; Interrogation_Position=2910; Antisense; AACATCGCTGTTATGCTGCAAGGAT
>probe:Drosophila_2:1628396_at:149:85; Interrogation_Position=2953; Antisense; AGTGCGGGTGTTCTGCTGACCATAC
>probe:Drosophila_2:1628396_at:418:65; Interrogation_Position=3032; Antisense; ATGGTCACACTGGACACGTTCGATT
>probe:Drosophila_2:1628396_at:181:469; Interrogation_Position=3049; Antisense; GTTCGATTCCTTACGTTTGTTGAGA
>probe:Drosophila_2:1628396_at:34:591; Interrogation_Position=3111; Antisense; TGGTCGCGATGCAGGCAGTTCCAAC
>probe:Drosophila_2:1628396_at:444:33; Interrogation_Position=3163; Antisense; ATCAAGCACTCCAAATCCAAGTCGG
>probe:Drosophila_2:1628396_at:204:289; Interrogation_Position=3185; Antisense; CGGAGACGAACAACACGCTGATCAT
>probe:Drosophila_2:1628396_at:340:135; Interrogation_Position=3199; Antisense; ACGCTGATCATTTCCGGCGGCGATG
>probe:Drosophila_2:1628396_at:279:441; Interrogation_Position=3220; Antisense; GATGGCTATGAGGACTTCCGCAACT
>probe:Drosophila_2:1628396_at:109:75; Interrogation_Position=3281; Antisense; AGGACAGCACCAACCATCTATTGAT

Paste this into a BLAST search page for me
GATATCCATTCAGAACTCAGCGCACTTAAGTGTTTCCATTCCAATACCCACGATGAGATTATCCGCCAGCACAAGAAGGCGGCTTGTCTGCGAGTAACATAACATCGCTGTTATGCTGCAAGGATAGTGCGGGTGTTCTGCTGACCATACATGGTCACACTGGACACGTTCGATTGTTCGATTCCTTACGTTTGTTGAGATGGTCGCGATGCAGGCAGTTCCAACATCAAGCACTCCAAATCCAAGTCGGCGGAGACGAACAACACGCTGATCATACGCTGATCATTTCCGGCGGCGATGGATGGCTATGAGGACTTCCGCAACTAGGACAGCACCAACCATCTATTGAT

Full Affymetrix probeset data:

Annotations for 1628396_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720