Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628397_at:

>probe:Drosophila_2:1628397_at:597:685; Interrogation_Position=1031; Antisense; TATACAGCTCCGAAGAAACCGCCTT
>probe:Drosophila_2:1628397_at:618:121; Interrogation_Position=1060; Antisense; AGCGGGAGCTCTAGTCTCATCAAGT
>probe:Drosophila_2:1628397_at:549:187; Interrogation_Position=1093; Antisense; AACACGATACTCTACCTGCGGGAGG
>probe:Drosophila_2:1628397_at:116:75; Interrogation_Position=1154; Antisense; AGGAGAACTTCAACCGGCAGGGCGT
>probe:Drosophila_2:1628397_at:268:575; Interrogation_Position=1174; Antisense; GGCGTCATCGACTACAATTTCATCT
>probe:Drosophila_2:1628397_at:221:665; Interrogation_Position=1186; Antisense; TACAATTTCATCTGTTTCCGCGACG
>probe:Drosophila_2:1628397_at:574:325; Interrogation_Position=1217; Antisense; GCGAGGTATTCGAGCTGCGGCTAAA
>probe:Drosophila_2:1628397_at:330:445; Interrogation_Position=1291; Antisense; GATGAGCAGACCCTGATTCGCCATG
>probe:Drosophila_2:1628397_at:670:563; Interrogation_Position=1330; Antisense; GGAATTTCGCGAGCGCAGCCAATTA
>probe:Drosophila_2:1628397_at:187:279; Interrogation_Position=1407; Antisense; CTAGCTTCTCTGTGGACTCTTTGAT
>probe:Drosophila_2:1628397_at:672:463; Interrogation_Position=1429; Antisense; GATTCCAATTTGTACGTTCTCTTCC
>probe:Drosophila_2:1628397_at:317:471; Interrogation_Position=1444; Antisense; GTTCTCTTCCGTTAAATCTGATGTT
>probe:Drosophila_2:1628397_at:650:723; Interrogation_Position=1480; Antisense; TTGATACGTTAGGACGCCACTCTCA
>probe:Drosophila_2:1628397_at:346:419; Interrogation_Position=985; Antisense; GAGCTCTGCTGCGATATGATTGACG

Paste this into a BLAST search page for me
TATACAGCTCCGAAGAAACCGCCTTAGCGGGAGCTCTAGTCTCATCAAGTAACACGATACTCTACCTGCGGGAGGAGGAGAACTTCAACCGGCAGGGCGTGGCGTCATCGACTACAATTTCATCTTACAATTTCATCTGTTTCCGCGACGGCGAGGTATTCGAGCTGCGGCTAAAGATGAGCAGACCCTGATTCGCCATGGGAATTTCGCGAGCGCAGCCAATTACTAGCTTCTCTGTGGACTCTTTGATGATTCCAATTTGTACGTTCTCTTCCGTTCTCTTCCGTTAAATCTGATGTTTTGATACGTTAGGACGCCACTCTCAGAGCTCTGCTGCGATATGATTGACG

Full Affymetrix probeset data:

Annotations for 1628397_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime