Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628398_at:

>probe:Drosophila_2:1628398_at:75:463; Interrogation_Position=1849; Antisense; GATTCTTTATGTTCTTCTCCATTAG
>probe:Drosophila_2:1628398_at:215:477; Interrogation_Position=1873; Antisense; GTTTACTGACCGTCTTTGTGGGACA
>probe:Drosophila_2:1628398_at:334:691; Interrogation_Position=1907; Antisense; TTTGATGATTGGTGCCTGGTTCGAT
>probe:Drosophila_2:1628398_at:309:613; Interrogation_Position=1936; Antisense; TGAATGGAACGTTCTTGGCCCCAGT
>probe:Drosophila_2:1628398_at:299:267; Interrogation_Position=1957; Antisense; CAGTGCTAACGATTCCCATGATGAT
>probe:Drosophila_2:1628398_at:163:269; Interrogation_Position=1973; Antisense; CATGATGATGTTCGCCGGCTTTGGA
>probe:Drosophila_2:1628398_at:404:571; Interrogation_Position=1989; Antisense; GGCTTTGGAGTGACCCTGCGTGATC
>probe:Drosophila_2:1628398_at:129:623; Interrogation_Position=2005; Antisense; TGCGTGATCTGCCAAGCTACTTAAG
>probe:Drosophila_2:1628398_at:441:43; Interrogation_Position=2098; Antisense; ATCGAGGTACCTTGGCCTGCGAGGA
>probe:Drosophila_2:1628398_at:329:71; Interrogation_Position=2122; Antisense; AGGCGCCGTACTGCCATTACAGGTA
>probe:Drosophila_2:1628398_at:279:63; Interrogation_Position=2200; Antisense; ATGTGATCGCGCTGGGAGTCATGAT
>probe:Drosophila_2:1628398_at:499:89; Interrogation_Position=2216; Antisense; AGTCATGATCCTGGTTTTCCGATTT
>probe:Drosophila_2:1628398_at:250:19; Interrogation_Position=2237; Antisense; ATTTGTGTCCTACGTGGTGCTGAAG
>probe:Drosophila_2:1628398_at:460:305; Interrogation_Position=2305; Antisense; CCTGTAGCCCATTCCTTGTATTATA

Paste this into a BLAST search page for me
GATTCTTTATGTTCTTCTCCATTAGGTTTACTGACCGTCTTTGTGGGACATTTGATGATTGGTGCCTGGTTCGATTGAATGGAACGTTCTTGGCCCCAGTCAGTGCTAACGATTCCCATGATGATCATGATGATGTTCGCCGGCTTTGGAGGCTTTGGAGTGACCCTGCGTGATCTGCGTGATCTGCCAAGCTACTTAAGATCGAGGTACCTTGGCCTGCGAGGAAGGCGCCGTACTGCCATTACAGGTAATGTGATCGCGCTGGGAGTCATGATAGTCATGATCCTGGTTTTCCGATTTATTTGTGTCCTACGTGGTGCTGAAGCCTGTAGCCCATTCCTTGTATTATA

Full Affymetrix probeset data:

Annotations for 1628398_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime