FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628401_at:

>probe:Drosophila_2:1628401_at:5:85; Interrogation_Position=213; Antisense; AGTGGCAGTGCAGCAGAGCGCATCA
>probe:Drosophila_2:1628401_at:343:417; Interrogation_Position=228; Antisense; GAGCGCATCAAGTGCTGCCATTGCA
>probe:Drosophila_2:1628401_at:185:87; Interrogation_Position=238; Antisense; AGTGCTGCCATTGCAGCCAGGGAAA
>probe:Drosophila_2:1628401_at:601:311; Interrogation_Position=268; Antisense; GCCAATGCAGCCGAATTCACCAAAG
>probe:Drosophila_2:1628401_at:469:107; Interrogation_Position=291; Antisense; AGAAAAGGCGACAGCCGCAGCAGCT
>probe:Drosophila_2:1628401_at:218:337; Interrogation_Position=313; Antisense; GCTGCCGCTACGGAAGCTGCAACAT
>probe:Drosophila_2:1628401_at:147:189; Interrogation_Position=333; Antisense; AACATCGGCGGCATCGACAGTCAGG
>probe:Drosophila_2:1628401_at:194:401; Interrogation_Position=348; Antisense; GACAGTCAGGGAAAAAGCCGCAGCA
>probe:Drosophila_2:1628401_at:240:349; Interrogation_Position=376; Antisense; GCAGTTGCTGTCAGGGCCAAGGCAT
>probe:Drosophila_2:1628401_at:686:263; Interrogation_Position=407; Antisense; CAGCAATTGCTGTCAGGGATTCGGT
>probe:Drosophila_2:1628401_at:425:265; Interrogation_Position=420; Antisense; CAGGGATTCGGTGACTGCAGTAGCA
>probe:Drosophila_2:1628401_at:498:657; Interrogation_Position=474; Antisense; TAAGGACAAAGTCGCCACTGCAGCT
>probe:Drosophila_2:1628401_at:446:501; Interrogation_Position=522; Antisense; GTCGAAAGTCACAAGGCAGAGCCAG
>probe:Drosophila_2:1628401_at:196:379; Interrogation_Position=61; Antisense; GAAGCTGCAGCCTCAGCTGCTCAGG

Paste this into a BLAST search page for me
AGTGGCAGTGCAGCAGAGCGCATCAGAGCGCATCAAGTGCTGCCATTGCAAGTGCTGCCATTGCAGCCAGGGAAAGCCAATGCAGCCGAATTCACCAAAGAGAAAAGGCGACAGCCGCAGCAGCTGCTGCCGCTACGGAAGCTGCAACATAACATCGGCGGCATCGACAGTCAGGGACAGTCAGGGAAAAAGCCGCAGCAGCAGTTGCTGTCAGGGCCAAGGCATCAGCAATTGCTGTCAGGGATTCGGTCAGGGATTCGGTGACTGCAGTAGCATAAGGACAAAGTCGCCACTGCAGCTGTCGAAAGTCACAAGGCAGAGCCAGGAAGCTGCAGCCTCAGCTGCTCAGG

Full Affymetrix probeset data:

Annotations for 1628401_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720