FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628404_at:

>probe:Drosophila_2:1628404_at:574:365; Interrogation_Position=1004; Antisense; GAATCTGGACGTCTTCGATTTCGAA
>probe:Drosophila_2:1628404_at:152:711; Interrogation_Position=1017; Antisense; TTCGATTTCGAACTGACGGCCGAGG
>probe:Drosophila_2:1628404_at:681:525; Interrogation_Position=1043; Antisense; GGTGGCCAAGTTGTCTAGCCTGGAC
>probe:Drosophila_2:1628404_at:389:237; Interrogation_Position=1079; Antisense; AATCTGTGACTTTGCATTCTTCCAT
>probe:Drosophila_2:1628404_at:690:569; Interrogation_Position=1114; Antisense; GGCATCCTGAGTTTACCTTCAAGAA
>probe:Drosophila_2:1628404_at:608:11; Interrogation_Position=1274; Antisense; ATTACTCGCAATTCGGTCATTATAC
>probe:Drosophila_2:1628404_at:589:309; Interrogation_Position=731; Antisense; CCACGTTTATTTGCAGCAGCGAGAT
>probe:Drosophila_2:1628404_at:110:123; Interrogation_Position=748; Antisense; AGCGAGATCTGGTCGACTTCTGCAA
>probe:Drosophila_2:1628404_at:363:387; Interrogation_Position=777; Antisense; GAAAACATTACCGTAACTGCCTACT
>probe:Drosophila_2:1628404_at:21:375; Interrogation_Position=811; Antisense; GATCCAAGGGAATCGCCAAGTTTAA
>probe:Drosophila_2:1628404_at:627:41; Interrogation_Position=849; Antisense; ATCGTGAGAGATCTGCCGGACCTGA
>probe:Drosophila_2:1628404_at:105:131; Interrogation_Position=868; Antisense; ACCTGATGGACATCCCTGAGGTGAA
>probe:Drosophila_2:1628404_at:54:299; Interrogation_Position=939; Antisense; CGCTGGATTATCGACACTGGTGTAT
>probe:Drosophila_2:1628404_at:227:299; Interrogation_Position=989; Antisense; CGCTCGCCTTAAACAGAATCTGGAC

Paste this into a BLAST search page for me
GAATCTGGACGTCTTCGATTTCGAATTCGATTTCGAACTGACGGCCGAGGGGTGGCCAAGTTGTCTAGCCTGGACAATCTGTGACTTTGCATTCTTCCATGGCATCCTGAGTTTACCTTCAAGAAATTACTCGCAATTCGGTCATTATACCCACGTTTATTTGCAGCAGCGAGATAGCGAGATCTGGTCGACTTCTGCAAGAAAACATTACCGTAACTGCCTACTGATCCAAGGGAATCGCCAAGTTTAAATCGTGAGAGATCTGCCGGACCTGAACCTGATGGACATCCCTGAGGTGAACGCTGGATTATCGACACTGGTGTATCGCTCGCCTTAAACAGAATCTGGAC

Full Affymetrix probeset data:

Annotations for 1628404_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720