Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628405_at:

>probe:Drosophila_2:1628405_at:257:147; Interrogation_Position=1016; Antisense; ACTACTATTGCAACAGCCAGGGCGA
>probe:Drosophila_2:1628405_at:475:81; Interrogation_Position=1034; Antisense; AGGGCGAGGCCACTTTGAACACCTG
>probe:Drosophila_2:1628405_at:13:667; Interrogation_Position=1068; Antisense; TACATTCTTCGATGAGTCACGTCAG
>probe:Drosophila_2:1628405_at:517:75; Interrogation_Position=1091; Antisense; AGGGATGCAAGTCCGACGACGACCT
>probe:Drosophila_2:1628405_at:402:413; Interrogation_Position=1111; Antisense; GACCTGTCCACATATGTGCCATTGA
>probe:Drosophila_2:1628405_at:135:555; Interrogation_Position=1150; Antisense; GGAGCCACCGCCGAAGGATCAGAAG
>probe:Drosophila_2:1628405_at:328:413; Interrogation_Position=1191; Antisense; GACCGATGCCGAATAAGCCCAATTA
>probe:Drosophila_2:1628405_at:329:549; Interrogation_Position=1252; Antisense; GGAGTAACTGACAACGCGACCCTAT
>probe:Drosophila_2:1628405_at:362:325; Interrogation_Position=1267; Antisense; GCGACCCTATGTATTTACCACTTAG
>probe:Drosophila_2:1628405_at:256:597; Interrogation_Position=750; Antisense; TGTGACCAACATTCCGCTGAGCGAT
>probe:Drosophila_2:1628405_at:261:219; Interrogation_Position=805; Antisense; AAGTCAGCCGATCCCAAGGTGTGTG
>probe:Drosophila_2:1628405_at:353:699; Interrogation_Position=903; Antisense; TTTAGGGTACTGTGTGTCCCGCCAG
>probe:Drosophila_2:1628405_at:67:445; Interrogation_Position=956; Antisense; GATGCCAGTATGCTACGTCGACGTT
>probe:Drosophila_2:1628405_at:55:639; Interrogation_Position=992; Antisense; TCGATTCGAATAACTGCTCCACCTA

Paste this into a BLAST search page for me
ACTACTATTGCAACAGCCAGGGCGAAGGGCGAGGCCACTTTGAACACCTGTACATTCTTCGATGAGTCACGTCAGAGGGATGCAAGTCCGACGACGACCTGACCTGTCCACATATGTGCCATTGAGGAGCCACCGCCGAAGGATCAGAAGGACCGATGCCGAATAAGCCCAATTAGGAGTAACTGACAACGCGACCCTATGCGACCCTATGTATTTACCACTTAGTGTGACCAACATTCCGCTGAGCGATAAGTCAGCCGATCCCAAGGTGTGTGTTTAGGGTACTGTGTGTCCCGCCAGGATGCCAGTATGCTACGTCGACGTTTCGATTCGAATAACTGCTCCACCTA

Full Affymetrix probeset data:

Annotations for 1628405_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime