FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628407_at:

>probe:Drosophila_2:1628407_at:208:335; Interrogation_Position=321; Antisense; GCTGCTGAAGGATGTCACGCCGGAA
>probe:Drosophila_2:1628407_at:718:41; Interrogation_Position=345; Antisense; ATCGGATTATGCATCGGAAGCCAAT
>probe:Drosophila_2:1628407_at:186:15; Interrogation_Position=368; Antisense; ATTATCCGGCAAATGAGGCGAGCGA
>probe:Drosophila_2:1628407_at:104:125; Interrogation_Position=419; Antisense; AGCCGGGCAGCACGGTATATTTCAT
>probe:Drosophila_2:1628407_at:716:21; Interrogation_Position=435; Antisense; ATATTTCATGAAACTGCCAGCGGCC
>probe:Drosophila_2:1628407_at:25:321; Interrogation_Position=460; Antisense; GCCGCCGAGGATACGTATTCTTCTA
>probe:Drosophila_2:1628407_at:601:55; Interrogation_Position=497; Antisense; ATGACAGCGATTTCCTGAACACCAC
>probe:Drosophila_2:1628407_at:622:519; Interrogation_Position=528; Antisense; GTGGAATCTCCGCAATGTGCCCAAG
>probe:Drosophila_2:1628407_at:612:597; Interrogation_Position=543; Antisense; TGTGCCCAAGCTGCGAATTAACGAT
>probe:Drosophila_2:1628407_at:350:377; Interrogation_Position=639; Antisense; GAAGCAGCCTTGTCTGGAACCGGAG
>probe:Drosophila_2:1628407_at:447:585; Interrogation_Position=761; Antisense; TGGAACGATCCTGGCCCTGGGCAGA
>probe:Drosophila_2:1628407_at:13:595; Interrogation_Position=778; Antisense; TGGGCAGACCGCGAGAAGATCATAT
>probe:Drosophila_2:1628407_at:424:209; Interrogation_Position=805; Antisense; AAGCAATCCACTTGCCATTTGGTGC
>probe:Drosophila_2:1628407_at:65:729; Interrogation_Position=823; Antisense; TTGGTGCCACGAAAGCCACTGGGAT

Paste this into a BLAST search page for me
GCTGCTGAAGGATGTCACGCCGGAAATCGGATTATGCATCGGAAGCCAATATTATCCGGCAAATGAGGCGAGCGAAGCCGGGCAGCACGGTATATTTCATATATTTCATGAAACTGCCAGCGGCCGCCGCCGAGGATACGTATTCTTCTAATGACAGCGATTTCCTGAACACCACGTGGAATCTCCGCAATGTGCCCAAGTGTGCCCAAGCTGCGAATTAACGATGAAGCAGCCTTGTCTGGAACCGGAGTGGAACGATCCTGGCCCTGGGCAGATGGGCAGACCGCGAGAAGATCATATAAGCAATCCACTTGCCATTTGGTGCTTGGTGCCACGAAAGCCACTGGGAT

Full Affymetrix probeset data:

Annotations for 1628407_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720